Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7645Btlr/Mmmh
Stock Number:
045701-MU
Citation ID:
RRID:MMRRC_045701-MU
Other Names:
R7645 (G1)
Major Collection:

Strain Information

Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, 6330416M07Rik, D5Bwg0860e, Rpipx
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, mBSC2, Nkcc1, sy-ns
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 38,021,363 bp
  • C to A, chromosome 2 at 76,899,681 bp
  • T to A, chromosome 2 at 90,037,747 bp
  • T to C, chromosome 2 at 119,816,906 bp
  • T to C, chromosome 3 at 33,825,169 bp
  • T to C, chromosome 4 at 22,377,037 bp
  • C to T, chromosome 4 at 90,224,777 bp
  • A to T, chromosome 4 at 107,906,974 bp
  • A to G, chromosome 4 at 133,211,329 bp
  • T to C, chromosome 4 at 156,255,183 bp
  • A to G, chromosome 5 at 88,640,617 bp
  • A to C, chromosome 5 at 100,660,250 bp
  • A to G, chromosome 6 at 134,725,925 bp
  • C to T, chromosome 6 at 149,185,031 bp
  • T to A, chromosome 7 at 45,587,963 bp
  • T to C, chromosome 7 at 141,648,658 bp
  • A to G, chromosome 8 at 31,236,204 bp
  • A to T, chromosome 8 at 83,242,553 bp
  • A to G, chromosome 8 at 95,034,764 bp
  • T to C, chromosome 9 at 49,565,003 bp
  • A to G, chromosome 9 at 105,767,198 bp
  • T to A, chromosome 9 at 109,114,412 bp
  • T to C, chromosome 9 at 114,613,637 bp
  • A to G, chromosome 10 at 7,867,576 bp
  • C to T, chromosome 10 at 62,494,978 bp
  • G to A, chromosome 10 at 128,681,391 bp
  • T to C, chromosome 11 at 50,238,546 bp
  • A to T, chromosome 11 at 106,775,593 bp
  • T to C, chromosome 12 at 88,176,258 bp
  • T to C, chromosome 12 at 105,623,430 bp
  • T to C, chromosome 13 at 37,931,034 bp
  • T to C, chromosome 13 at 81,694,444 bp
  • T to A, chromosome 13 at 111,256,255 bp
  • T to C, chromosome 14 at 65,827,181 bp
  • C to T, chromosome 14 at 121,597,663 bp
  • T to C, chromosome 15 at 81,780,602 bp
  • C to T, chromosome 15 at 86,235,541 bp
  • T to C, chromosome 15 at 101,412,643 bp
  • T to A, chromosome 16 at 35,734,068 bp
  • TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,295 bp
  • T to C, chromosome 17 at 34,200,212 bp
  • T to A, chromosome 17 at 37,270,729 bp
  • A to G, chromosome 17 at 45,534,989 bp
  • A to G, chromosome 18 at 5,099,663 bp
  • C to T, chromosome 18 at 36,735,393 bp
  • T to C, chromosome 18 at 57,896,378 bp
  • A to T, chromosome 19 at 11,523,940 bp
  • T to C, chromosome 19 at 13,191,573 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7645 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045701-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.