Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7674Btlr/Mmmh
Stock Number:
045744-MU
Citation ID:
RRID:MMRRC_045744-MU
Other Names:
R7674 (G1)
Major Collection:

Strain Information

Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Nucks1
Name: nuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms: Nucks, 2700010L10Rik, 8430423A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98415
Homologene: 23377
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Fbxw8
Name: F-box and WD-40 domain protein 8
Synonyms: FBXO29, Fbx29, FBW8, FBW6, 4930438M06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231672
Homologene: 17731
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,389,488 bp
  • G to A, chromosome 1 at 85,579,092 bp
  • C to A, chromosome 1 at 131,931,106 bp
  • C to T, chromosome 1 at 136,468,820 bp
  • G to A, chromosome 1 at 156,655,908 bp
  • A to T, chromosome 1 at 181,707,533 bp
  • T to C, chromosome 2 at 31,689,829 bp
  • T to A, chromosome 2 at 42,652,909 bp
  • A to C, chromosome 2 at 85,904,536 bp
  • A to T, chromosome 2 at 90,003,045 bp
  • T to G, chromosome 3 at 108,462,991 bp
  • T to C, chromosome 4 at 56,792,075 bp
  • T to A, chromosome 4 at 143,655,605 bp
  • C to T, chromosome 4 at 148,012,694 bp
  • G to A, chromosome 5 at 36,397,952 bp
  • A to T, chromosome 5 at 69,519,229 bp
  • A to T, chromosome 5 at 76,974,826 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • A to T, chromosome 5 at 118,124,971 bp
  • T to A, chromosome 5 at 137,467,108 bp
  • G to T, chromosome 6 at 115,932,333 bp
  • G to T, chromosome 6 at 120,215,205 bp
  • T to C, chromosome 6 at 124,039,362 bp
  • A to C, chromosome 7 at 35,695,309 bp
  • T to C, chromosome 7 at 45,455,071 bp
  • A to T, chromosome 7 at 104,861,447 bp
  • A to T, chromosome 7 at 141,639,825 bp
  • A to G, chromosome 7 at 143,587,103 bp
  • C to A, chromosome 8 at 25,018,264 bp
  • A to G, chromosome 8 at 25,057,298 bp
  • A to C, chromosome 8 at 27,540,119 bp
  • A to T, chromosome 8 at 69,228,685 bp
  • A to T, chromosome 8 at 86,665,758 bp
  • C to A, chromosome 8 at 93,514,269 bp
  • T to C, chromosome 8 at 94,866,562 bp
  • A to T, chromosome 8 at 105,697,286 bp
  • AGG to AG, chromosome 8 at 122,383,556 bp
  • C to A, chromosome 8 at 124,537,882 bp
  • A to G, chromosome 9 at 20,171,253 bp
  • C to A, chromosome 9 at 123,216,006 bp
  • A to G, chromosome 10 at 22,693,994 bp
  • T to A, chromosome 11 at 31,081,435 bp
  • T to A, chromosome 11 at 74,667,720 bp
  • A to T, chromosome 11 at 101,174,649 bp
  • T to A, chromosome 11 at 110,219,297 bp
  • T to C, chromosome 11 at 116,222,568 bp
  • G to T, chromosome 12 at 100,945,232 bp
  • T to A, chromosome 12 at 114,435,217 bp
  • C to T, chromosome 13 at 92,131,406 bp
  • C to A, chromosome 13 at 92,212,503 bp
  • C to T, chromosome 13 at 93,442,599 bp
  • C to A, chromosome 14 at 12,411,581 bp
  • A to G, chromosome 14 at 52,450,442 bp
  • A to T, chromosome 14 at 61,367,637 bp
  • G to A, chromosome 14 at 70,078,077 bp
  • A to T, chromosome 14 at 118,611,487 bp
  • C to T, chromosome 15 at 8,293,101 bp
  • A to G, chromosome 17 at 37,700,682 bp
  • A to T, chromosome 19 at 12,461,387 bp
  • G to C, chromosome 19 at 33,825,028 bp
  • G to C, chromosome 19 at 58,675,154 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7674 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045744-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.