Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7674Btlr/Mmmh
Stock Number:
045744-MU
Citation ID:
RRID:MMRRC_045744-MU
Other Names:
R7674 (G1)
Major Collection:

Strain Information

Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Nucks1
Name: nuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms: Nucks, 2700010L10Rik, 8430423A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98415
Homologene: 23377
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Fbxw8
Name: F-box and WD-40 domain protein 8
Synonyms: FBXO29, Fbx29, FBW8, FBW6, 4930438M06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231672
Homologene: 17731
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Kpna3
Name: karyopherin subunit alpha 3
Synonyms: IPOA4, importin alpha 4, importin alpha 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16648
VEGA: 14
HGNC: HGNC:6396
Homologene: 20520
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Abl1
Name: c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms: c-Abl, E430008G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Rho
Name: rhodopsin
Synonyms: Red Opsin, L opsin, LWS opsin, Long Wavelength Sensitive opsin, Rod Opsin, opsin 2, RP4, Opn2, Ops, Noerg1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212541
Homologene: 68068
Alkal1
Name: ALK and LTK ligand 1
Synonyms: EG620393, Fam150a, Augmentor beta, Augbeta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 620393
Homologene: 82437
Zc3h18
Name: zinc finger CCCH-type containing 18
Synonyms: 1190001B23Rik, 5830416A07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76014
Homologene: 44894
Elapor1
Name: endosome-lysosome associated apoptosis and autophagy regulator 1
Synonyms: 5330417C22Rik, Inceptor, Iir
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229722
Homologene: 23249
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Msh3
Name: mutS homolog 3
Synonyms: D13Em1, Rep-3, Rep3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17686
HGNC: HGNC:7326
Homologene: 1829
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Srp72
Name: signal recognition particle 72
Synonyms: 72kDa, 5730576P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66661
Homologene: 38254
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Cog2
Name: component of oligomeric golgi complex 2
Synonyms: 1190002B08Rik, 2700012E02Rik, Cog2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76332
HGNC: HGNC:6546
Homologene: 7206
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Or10al3
Name: olfactory receptor family 10 subfamily AL member 3
Synonyms: MOR263-7, GA_x6K02T2PSCP-2159633-2160598, Olfr119
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258095
Homologene: 17195
Gys1
Name: glycogen synthase 1, muscle
Synonyms: Gys3, MGS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14936
HGNC: HGNC:4706
Homologene: 113557
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Or8b12i
Name: olfactory receptor family 8 subfamily B member 12I
Synonyms: GA_x6K02T2PVTD-13912679-13911744, MOR141-1, Olfr870
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57251
Homologene: 138319
Ces5a
Name: carboxylesterase 5A
Synonyms: LOC244598, 1700081L16Rik, 1700122C07Rik, cauxin, Ces7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67935
Homologene: 74305
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330406
Homologene: 18328
Mpeg1
Name: macrophage expressed gene 1
Synonyms: Mpg-1, MPS1, Perforin-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Dok4
Name: docking protein 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114255
Homologene: 10009
Pramel22
Name: PRAME like 22
Synonyms: Gm13088
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277668
Homologene: 129883
Dpy19l3
Name: dpy-19 like C-mannosyltransferase 3
Synonyms: 9330164H19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233115
Homologene: 18692
Jmy
Name: junction-mediating and regulatory protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 57748
VEGA: 13
Homologene: 10955
Sorcs2
Name: sortilin-related VPS10 domain containing receptor 2
Synonyms: VPS10 domain receptor protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81840
Homologene: 56899
Or4e2
Name: olfactory receptor family 4 subfamily E member 2
Synonyms: GA_x6K02T2RJGY-534312-533386, MOR244-3, MOR83, Olfr1509
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57271
HGNC: HGNC:8297
Homologene: 41378
Or5m12
Name: olfactory receptor family 5 subfamily M member 12
Synonyms: GA_x6K02T2Q125-47384320-47383337, MOR197-1, Olfr1024
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257900
Homologene: 128271
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Tm2d2
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69742
Homologene: 12328
Sp110
Name: Sp110 nuclear body protein
Synonyms: 52kDa, Ipr1, 5830484A20Rik, 5031415C07Rik, Ifi75
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109032
HGNC: HGNC:5401
Homologene: 82192
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: GLUT-12, Glut12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353169
Homologene: 59263
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Yipf7
Name: Yip1 domain family, member 7
Synonyms: Yip1b, 2310016N21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75581
Homologene: 69367
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: Grf2, 6330417G04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Pnlip
Name: pancreatic lipase
Synonyms: pancreatic triglyceride lipase, PTL, 1810007A24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69060
VEGA: 19
HGNC: HGNC:9155
Homologene: 30999
Gm5519
Name: predicted pseudogene 5519
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433241
VEGA: 19
Plekha2
Name: pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms: TAPP2, 6430512N22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 83436
Homologene: 41822
Or4c127
Name: olfactory receptor family 4 subfamily C member 127
Synonyms: GA_x6K02T2Q125-51434523-51435437, MOR234-1, Olfr1262
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258976
Homologene: 74064
Ccr10
Name: C-C motif chemokine receptor 10
Synonyms: CCR10, GPR2, Cmkbr9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12777
HGNC: HGNC:4474
Homologene: 7271
Egr3
Name: early growth response 3
Synonyms: Pilot
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13655
VEGA: 14
HGNC: HGNC:3240
Homologene: 37923
Tor3a
Name: torsin family 3, member A
Synonyms: Adir
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30935
Homologene: 23359
Ighv6-6
Name: immunoglobulin heavy variable 6-6
Synonyms: Gm16695
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238427
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,389,488 bp
  • G to A, chromosome 1 at 85,579,092 bp
  • C to A, chromosome 1 at 131,931,106 bp
  • C to T, chromosome 1 at 136,468,820 bp
  • G to A, chromosome 1 at 156,655,908 bp
  • A to T, chromosome 1 at 181,707,533 bp
  • T to C, chromosome 2 at 31,689,829 bp
  • T to A, chromosome 2 at 42,652,909 bp
  • A to C, chromosome 2 at 85,904,536 bp
  • A to T, chromosome 2 at 90,003,045 bp
  • T to G, chromosome 3 at 108,462,991 bp
  • T to C, chromosome 4 at 56,792,075 bp
  • T to A, chromosome 4 at 143,655,605 bp
  • C to T, chromosome 4 at 148,012,694 bp
  • G to A, chromosome 5 at 36,397,952 bp
  • A to T, chromosome 5 at 69,519,229 bp
  • A to T, chromosome 5 at 76,974,826 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • A to T, chromosome 5 at 118,124,971 bp
  • T to A, chromosome 5 at 137,467,108 bp
  • G to T, chromosome 6 at 115,932,333 bp
  • G to T, chromosome 6 at 120,215,205 bp
  • T to C, chromosome 6 at 124,039,362 bp
  • A to C, chromosome 7 at 35,695,309 bp
  • T to C, chromosome 7 at 45,455,071 bp
  • A to T, chromosome 7 at 104,861,447 bp
  • A to T, chromosome 7 at 141,639,825 bp
  • A to G, chromosome 7 at 143,587,103 bp
  • C to A, chromosome 8 at 25,018,264 bp
  • A to G, chromosome 8 at 25,057,298 bp
  • A to C, chromosome 8 at 27,540,119 bp
  • A to T, chromosome 8 at 69,228,685 bp
  • A to T, chromosome 8 at 86,665,758 bp
  • C to A, chromosome 8 at 93,514,269 bp
  • T to C, chromosome 8 at 94,866,562 bp
  • A to T, chromosome 8 at 105,697,286 bp
  • AGG to AG, chromosome 8 at 122,383,556 bp
  • C to A, chromosome 8 at 124,537,882 bp
  • A to G, chromosome 9 at 20,171,253 bp
  • C to A, chromosome 9 at 123,216,006 bp
  • A to G, chromosome 10 at 22,693,994 bp
  • T to A, chromosome 11 at 31,081,435 bp
  • T to A, chromosome 11 at 74,667,720 bp
  • A to T, chromosome 11 at 101,174,649 bp
  • T to A, chromosome 11 at 110,219,297 bp
  • T to C, chromosome 11 at 116,222,568 bp
  • G to T, chromosome 12 at 100,945,232 bp
  • T to A, chromosome 12 at 114,435,217 bp
  • C to T, chromosome 13 at 92,131,406 bp
  • C to A, chromosome 13 at 92,212,503 bp
  • C to T, chromosome 13 at 93,442,599 bp
  • C to A, chromosome 14 at 12,411,581 bp
  • A to G, chromosome 14 at 52,450,442 bp
  • A to T, chromosome 14 at 61,367,637 bp
  • G to A, chromosome 14 at 70,078,077 bp
  • A to T, chromosome 14 at 118,611,487 bp
  • C to T, chromosome 15 at 8,293,101 bp
  • A to G, chromosome 17 at 37,700,682 bp
  • A to T, chromosome 19 at 12,461,387 bp
  • G to C, chromosome 19 at 33,825,028 bp
  • G to C, chromosome 19 at 58,675,154 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7674 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045744-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.