Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7736Btlr/Mmmh
Stock Number:
045792-MU
Citation ID:
RRID:MMRRC_045792-MU
Other Names:
R7736 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 63,308,007 bp
  • T to G, chromosome 1 at 71,319,964 bp
  • T to A, chromosome 1 at 75,169,532 bp
  • T to C, chromosome 1 at 171,226,172 bp
  • A to T, chromosome 2 at 36,640,185 bp
  • T to A, chromosome 2 at 76,909,230 bp
  • T to C, chromosome 2 at 85,664,414 bp
  • A to G, chromosome 2 at 97,630,360 bp
  • A to T, chromosome 2 at 120,433,814 bp
  • A to T, chromosome 2 at 132,381,580 bp
  • G to A, chromosome 2 at 154,312,105 bp
  • A to G, chromosome 2 at 167,191,971 bp
  • G to A, chromosome 2 at 170,387,164 bp
  • A to T, chromosome 3 at 83,940,568 bp
  • A to G, chromosome 3 at 90,389,433 bp
  • T to A, chromosome 3 at 106,767,936 bp
  • T to G, chromosome 3 at 132,178,014 bp
  • T to G, chromosome 3 at 155,087,110 bp
  • A to G, chromosome 4 at 9,621,930 bp
  • A to G, chromosome 4 at 12,053,455 bp
  • T to C, chromosome 4 at 56,776,920 bp
  • T to C, chromosome 4 at 72,199,334 bp
  • C to T, chromosome 4 at 120,095,543 bp
  • T to C, chromosome 4 at 131,788,382 bp
  • C to T, chromosome 4 at 152,032,466 bp
  • T to C, chromosome 4 at 154,969,747 bp
  • G to A, chromosome 5 at 109,452,891 bp
  • A to G, chromosome 5 at 124,123,030 bp
  • A to G, chromosome 5 at 135,731,122 bp
  • G to A, chromosome 5 at 145,195,509 bp
  • T to C, chromosome 6 at 83,005,584 bp
  • G to C, chromosome 7 at 24,781,211 bp
  • C to T, chromosome 7 at 45,585,193 bp
  • T to A, chromosome 7 at 97,457,940 bp
  • A to G, chromosome 7 at 99,539,774 bp
  • A to T, chromosome 7 at 121,990,524 bp
  • A to T, chromosome 7 at 131,116,896 bp
  • A to T, chromosome 8 at 14,980,583 bp
  • A to G, chromosome 8 at 69,065,554 bp
  • A to G, chromosome 8 at 69,881,421 bp
  • T to C, chromosome 8 at 79,655,765 bp
  • T to C, chromosome 8 at 95,005,337 bp
  • A to G, chromosome 8 at 104,261,555 bp
  • A to T, chromosome 9 at 75,893,790 bp
  • A to G, chromosome 9 at 88,461,668 bp
  • G to T, chromosome 9 at 108,045,692 bp
  • C to A, chromosome 10 at 7,702,364 bp
  • T to A, chromosome 10 at 22,664,818 bp
  • T to A, chromosome 10 at 23,960,999 bp
  • T to C, chromosome 10 at 24,282,710 bp
  • A to C, chromosome 10 at 51,615,453 bp
  • C to T, chromosome 11 at 22,973,510 bp
  • C to T, chromosome 11 at 59,463,190 bp
  • T to A, chromosome 11 at 78,922,366 bp
  • G to T, chromosome 11 at 95,076,203 bp
  • T to C, chromosome 11 at 103,497,459 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • A to T, chromosome 11 at 121,299,647 bp
  • T to A, chromosome 12 at 33,053,520 bp
  • C to A, chromosome 12 at 85,012,983 bp
  • T to A, chromosome 14 at 43,714,799 bp
  • T to G, chromosome 14 at 57,445,664 bp
  • C to T, chromosome 14 at 59,251,145 bp
  • A to T, chromosome 15 at 44,628,404 bp
  • T to A, chromosome 16 at 11,367,724 bp
  • T to A, chromosome 17 at 35,881,676 bp
  • A to T, chromosome 17 at 37,610,412 bp
  • A to G, chromosome 18 at 11,084,379 bp
  • T to C, chromosome 18 at 23,877,955 bp
  • T to C, chromosome 18 at 43,477,317 bp
  • A to G, chromosome 19 at 6,969,623 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7736 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045792-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.