Strain Name:
C57BL/6J-MtgxR7736Btlr/Mmmh
Stock Number:
045792-MU
Citation ID:
RRID:MMRRC_045792-MU
Other Names:
R7736 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Adgrg1
Name: adhesion G protein-coupled receptor G1
Synonyms: Cyt28, Gpr56
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14766
HGNC: HGNC:4512
Homologene: 4156
Ebag9
Name: estrogen receptor-binding fragment-associated gene 9
Synonyms: Rcas1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 55960
VEGA: 15
HGNC: HGNC:3123
Homologene: 3107
Syncrip
Name: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: RRM RNA binding protein GRY-RBP, GRY-RBP, pp68, Nsap1l, Nsap1, 4632417O19Rik, 2610109K23Rik, hnRNP Q
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56403
Homologene: 4648
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Foxk2
Name: forkhead box K2
Synonyms: 5730434B08Rik, 1110054H05Rik, Ilf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68837
HGNC: HGNC:6036
Homologene: 18748
Dhx16
Name: DEAH-box helicase 16
Synonyms: 2410006N22Rik, DBP2, Ddx16, DEAH (Asp-Glu-Ala-His) box polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69192
HGNC: HGNC:2739
Homologene: 2658
Cklf
Name: chemokine-like factor
Synonyms: CKLF5, chemokine-like factor 4, Cklf6, HSPC224, UCK-1, CKLF4, CKLF3, CKLF2, CKLF1, C32, 1700001C14Rik, A730028G07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75458
Homologene: 9663
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Prokr2
Name: prokineticin receptor 2
Synonyms: PKR2, B830005M06Rik, EG-VEGRF2, Gpr73l1, Gpcr73l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 246313
Homologene: 16368
Dkk2
Name: dickkopf WNT signaling pathway inhibitor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56811
HGNC: HGNC:2892
Homologene: 8681
M1ap
Name: meiosis 1 associated protein
Synonyms: D6Mm5e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110958
Homologene: 13210
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Gga2
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms: 1200007E24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74105
Homologene: 22860
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Moxd1
Name: monooxygenase, DBH-like 1
Synonyms: 3230402N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59012
Homologene: 22904
Lrrc4c
Name: leucine rich repeat containing 4C
Synonyms: 6430556C10Rik, netrin g1 ligand, NGL-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241568
Homologene: 18696
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Bcat2
Name: branched chain aminotransferase 2, mitochondrial
Synonyms: Eca40, Bcat-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12036
HGNC: HGNC:977
Homologene: 81684
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Mapre2
Name: microtubule-associated protein, RP/EB family, member 2
Synonyms: D18Abb1e, RP1, EB2, C820009F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 212307
HGNC: HGNC:6891
Homologene: 134539
Cdhr3
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68764
VEGA: 12
Homologene: 45146
Arrb1
Name: arrestin, beta 1
Synonyms: 1200006I17Rik, beta-arrestin1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109689
HGNC: HGNC:711
Homologene: 2981
Ceacam10
Name: CEA cell adhesion molecule 10
Synonyms: Bgp3, Cea10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26366
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210198
VEGA: 10
Homologene: 17529
Zfp867
Name: zinc finger protein 867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237775
Homologene: 64827
Plcb3
Name: phospholipase C, beta 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18797
VEGA: 19
HGNC: HGNC:9056
Homologene: 47960
Pitpnm2
Name: phosphatidylinositol transfer protein, membrane-associated 2
Synonyms: RDGBA2, NIR3, Rdgb2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19679
Homologene: 7915
Cd53
Name: CD53 antigen
Synonyms: Ox-44, Tspan25
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12508
HGNC: HGNC:1686
Homologene: 20152
Taar4
Name: trace amine-associated receptor 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209513
Homologene: 45509
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433492
Homologene: 128535
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: CLIP-2, 1110031K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68709
Homologene: 17713
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Ptgis
Name: prostaglandin I2 (prostacyclin) synthase
Synonyms: Pgi2, Pgis, Cyp8a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19223
HGNC: HGNC:9603
Homologene: 37374
Bcas1
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76960
HGNC: HGNC:974
Homologene: 2714
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Slc18a1
Name: solute carrier family 18 (vesicular monoamine), member 1
Synonyms: 4832416I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110877
Homologene: 20664
Ift88
Name: intraflagellar transport 88
Synonyms: Tg737, polaris, Oak Ridge polycystic kidneys, orpk, IFT88, fxo, TgN737Rpw, Tg737Rpw, Ttc10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21821
Homologene: 4761
Otud4
Name: OTU domain containing 4
Synonyms: 4930431L18Rik, D8Ertd69e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73945
Homologene: 35370
Ganc
Name: glucosidase, alpha; neutral C
Synonyms: 5830445O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76051
HGNC: HGNC:4139
Homologene: 25627
Itga3
Name: integrin alpha 3
Synonyms: VLA-3 alpha 3, alpha3-integrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: Glut12, GLUT-12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353169
Homologene: 59263
Gata6
Name: GATA binding protein 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14465
VEGA: 18
HGNC: HGNC:4174
Homologene: 68449
Slc27a3
Name: solute carrier family 27 (fatty acid transporter), member 3
Synonyms: fatty acid transport protein 3, FATP3, Acsvl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26568
Homologene: 11529
Eif3j2
Name: eukaryotic translation initiation factor 3, subunit J2
Synonyms: Gm9781
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042807
HGNC: HGNC:3270
Homologene: 37845
Apoa2
Name: apolipoprotein A-II
Synonyms: ApoA-II, Hdl-1, Apoa-2, Alp-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11807
HGNC: HGNC:601
Homologene: 1242
Or14j4
Name: olfactory receptor family 14 subfamily J member 4
Synonyms: MOR218-11P, GA_x6K02T2PSCP-2070203-2069271, Olfr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257908
Homologene: 115497
Or1j16
Name: olfactory receptor family 1 subfamily J member 16
Synonyms: GA_x6K02T2NLDC-33334179-33335114, MOR136-7, Olfr345
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258947
Homologene: 45069
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Phf11
Name: PHD finger protein 11
Synonyms: Phf11-ps, Gm6904
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 628693
VEGA: 14
Zrsr2-ps1
Name: zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2, pseudogene 1
Synonyms: U2afbp-rs, Irlgs2, D11Ncvs75, 35kDa, SP2, U2af1-rs1, Zrsr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22183
Homologene: 84793
Tas1r1
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, Gpr70, T1R1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110326
Homologene: 12888
Zkscan14
Name: zinc finger with KRAB and SCAN domains 14
Synonyms: 2810437E14Rik, 2310046C23Rik, Zfp99
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67235
Homologene: 11342
Kctd14
Name: potassium channel tetramerisation domain containing 14
Synonyms: D7Ertd760e, AI449310
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233529
Homologene: 11396
Or5g26
Name: olfactory receptor family 5 subfamily G member 26
Synonyms: OR93, 912-93, Olfr4-3, GA_x6K02T2Q125-47143827-47142871, MOR175-1, Olfr154
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27216
Homologene: 104131
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Zfand2b
Name: zinc finger, AN1 type domain 2B
Synonyms: 1110060O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68818
Homologene: 32671
Gm7324
Name: predicted gene 7324
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 652988
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 63,308,007 bp
  • T to G, chromosome 1 at 71,319,964 bp
  • T to A, chromosome 1 at 75,169,532 bp
  • T to C, chromosome 1 at 171,226,172 bp
  • A to T, chromosome 2 at 36,640,185 bp
  • T to A, chromosome 2 at 76,909,230 bp
  • T to C, chromosome 2 at 85,664,414 bp
  • A to G, chromosome 2 at 97,630,360 bp
  • A to T, chromosome 2 at 120,433,814 bp
  • A to T, chromosome 2 at 132,381,580 bp
  • G to A, chromosome 2 at 154,312,105 bp
  • A to G, chromosome 2 at 167,191,971 bp
  • G to A, chromosome 2 at 170,387,164 bp
  • A to T, chromosome 3 at 83,940,568 bp
  • A to G, chromosome 3 at 90,389,433 bp
  • T to A, chromosome 3 at 106,767,936 bp
  • T to G, chromosome 3 at 132,178,014 bp
  • T to G, chromosome 3 at 155,087,110 bp
  • A to G, chromosome 4 at 9,621,930 bp
  • A to G, chromosome 4 at 12,053,455 bp
  • T to C, chromosome 4 at 56,776,920 bp
  • T to C, chromosome 4 at 72,199,334 bp
  • C to T, chromosome 4 at 120,095,543 bp
  • T to C, chromosome 4 at 131,788,382 bp
  • C to T, chromosome 4 at 152,032,466 bp
  • T to C, chromosome 4 at 154,969,747 bp
  • G to A, chromosome 5 at 109,452,891 bp
  • A to G, chromosome 5 at 124,123,030 bp
  • A to G, chromosome 5 at 135,731,122 bp
  • G to A, chromosome 5 at 145,195,509 bp
  • T to C, chromosome 6 at 83,005,584 bp
  • G to C, chromosome 7 at 24,781,211 bp
  • C to T, chromosome 7 at 45,585,193 bp
  • T to A, chromosome 7 at 97,457,940 bp
  • A to G, chromosome 7 at 99,539,774 bp
  • A to T, chromosome 7 at 121,990,524 bp
  • A to T, chromosome 7 at 131,116,896 bp
  • A to T, chromosome 8 at 14,980,583 bp
  • A to G, chromosome 8 at 69,065,554 bp
  • A to G, chromosome 8 at 69,881,421 bp
  • T to C, chromosome 8 at 79,655,765 bp
  • T to C, chromosome 8 at 95,005,337 bp
  • A to G, chromosome 8 at 104,261,555 bp
  • A to T, chromosome 9 at 75,893,790 bp
  • A to G, chromosome 9 at 88,461,668 bp
  • G to T, chromosome 9 at 108,045,692 bp
  • C to A, chromosome 10 at 7,702,364 bp
  • T to A, chromosome 10 at 22,664,818 bp
  • T to A, chromosome 10 at 23,960,999 bp
  • T to C, chromosome 10 at 24,282,710 bp
  • A to C, chromosome 10 at 51,615,453 bp
  • C to T, chromosome 11 at 22,973,510 bp
  • C to T, chromosome 11 at 59,463,190 bp
  • T to A, chromosome 11 at 78,922,366 bp
  • G to T, chromosome 11 at 95,076,203 bp
  • T to C, chromosome 11 at 103,497,459 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • A to T, chromosome 11 at 121,299,647 bp
  • T to A, chromosome 12 at 33,053,520 bp
  • C to A, chromosome 12 at 85,012,983 bp
  • T to A, chromosome 14 at 43,714,799 bp
  • T to G, chromosome 14 at 57,445,664 bp
  • C to T, chromosome 14 at 59,251,145 bp
  • A to T, chromosome 15 at 44,628,404 bp
  • T to A, chromosome 16 at 11,367,724 bp
  • T to A, chromosome 17 at 35,881,676 bp
  • A to T, chromosome 17 at 37,610,412 bp
  • A to G, chromosome 18 at 11,084,379 bp
  • T to C, chromosome 18 at 23,877,955 bp
  • T to C, chromosome 18 at 43,477,317 bp
  • A to G, chromosome 19 at 6,969,623 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7736 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045792-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.