Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7872Btlr/Mmmh
Stock Number:
045924-MU
Citation ID:
RRID:MMRRC_045924-MU
Other Names:
R7872 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Poli
Name: polymerase (DNA directed), iota
Synonyms: Rad30b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26447
HGNC: HGNC:9182
Homologene: 5209
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,421,886 bp
  • T to C, chromosome 2 at 25,298,190 bp
  • T to C, chromosome 2 at 31,640,219 bp
  • A to G, chromosome 2 at 72,371,754 bp
  • C to T, chromosome 2 at 91,490,716 bp
  • A to T, chromosome 2 at 104,706,492 bp
  • T to A, chromosome 2 at 130,970,227 bp
  • T to C, chromosome 2 at 180,986,578 bp
  • A to C, chromosome 3 at 16,006,321 bp
  • T to A, chromosome 3 at 57,665,386 bp
  • T to A, chromosome 3 at 87,752,215 bp
  • A to T, chromosome 3 at 113,622,447 bp
  • A to T, chromosome 3 at 158,353,462 bp
  • A to T, chromosome 4 at 11,254,062 bp
  • A to G, chromosome 4 at 43,563,332 bp
  • C to T, chromosome 4 at 45,051,699 bp
  • T to G, chromosome 4 at 108,517,518 bp
  • T to C, chromosome 4 at 139,393,062 bp
  • A to T, chromosome 4 at 140,727,762 bp
  • C to T, chromosome 4 at 147,862,918 bp
  • G to A, chromosome 5 at 99,234,544 bp
  • T to A, chromosome 5 at 109,221,353 bp
  • A to T, chromosome 6 at 39,347,310 bp
  • A to G, chromosome 6 at 48,620,470 bp
  • C to T, chromosome 6 at 68,704,929 bp
  • T to A, chromosome 7 at 5,220,614 bp
  • T to C, chromosome 7 at 7,287,781 bp
  • T to C, chromosome 7 at 20,101,914 bp
  • A to G, chromosome 7 at 102,016,795 bp
  • A to G, chromosome 7 at 102,714,182 bp
  • T to A, chromosome 7 at 123,179,834 bp
  • A to G, chromosome 7 at 140,466,783 bp
  • A to G, chromosome 7 at 141,846,113 bp
  • T to C, chromosome 8 at 24,611,100 bp
  • T to A, chromosome 8 at 84,583,654 bp
  • A to G, chromosome 9 at 8,609,909 bp
  • T to C, chromosome 10 at 12,698,129 bp
  • C to T, chromosome 10 at 58,610,526 bp
  • T to C, chromosome 11 at 33,966,275 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • T to C, chromosome 12 at 4,278,186 bp
  • CT to C, chromosome 12 at 73,104,239 bp
  • T to A, chromosome 13 at 11,595,724 bp
  • C to A, chromosome 13 at 13,635,865 bp
  • A to G, chromosome 13 at 22,556,234 bp
  • A to G, chromosome 13 at 55,069,737 bp
  • C to A, chromosome 13 at 95,086,839 bp
  • G to A, chromosome 13 at 112,998,987 bp
  • A to G, chromosome 14 at 8,083,724 bp
  • A to C, chromosome 15 at 28,245,684 bp
  • A to G, chromosome 15 at 36,485,843 bp
  • A to G, chromosome 15 at 58,448,360 bp
  • G to A, chromosome 15 at 98,000,577 bp
  • T to G, chromosome 16 at 15,715,006 bp
  • A to G, chromosome 16 at 20,708,460 bp
  • T to C, chromosome 16 at 36,023,195 bp
  • T to A, chromosome 17 at 49,439,533 bp
  • A to T, chromosome 18 at 3,511,406 bp
  • A to G, chromosome 18 at 70,522,820 bp
  • T to A, chromosome 19 at 17,119,434 bp
  • T to C, chromosome 19 at 32,125,365 bp
  • C to T, chromosome 19 at 34,243,439 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7872 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045924-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.