Strain Detail Sheet

Strain Name:
FVB/NOve-Trp53em1Ove/Mmmh
Stock Number:
065575-MU
Citation ID:
RRID:MMRRC_065575-MU

Strain Information

Gene Details

Trp53em1Ove
Name: transformation related protein 53; endonuclease-mediated mutation 1, Paul A Overbeek
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: CRISPR
Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
Alteration at locus: CRISPR
NCBI: 22059
Homologene: 460
Genome Browser [Click image to go to Jbrowse]



Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
Targeted, 24-bp, in-frame deletion in the DNA binding domain of Trp53.

HGVS nomenclature
  • Genbank RefSeq - mRNA: NM_011640.3
  • Genbank RefSeq, protein: NP_035770.2
  • Variant, nucleic acid level: c.490_514del
  • Variant, amino acid level, predicted: p.Gln164Alafs*72
  • Check this variant: LUMC Mutalyzer
Genotype Determination

Strain Description

Phenotype
On the FVB/N background, inactivation of Trp53 results in a phenotype that is reproducibly and consistently different from the phenotype for loss of Trp53 on the C57BL/6 background. On the FVB/N background, 100% of the homozygous mutant mice develop multiple hemangiosarcomas in their body wall by 8 weeks of age. These mice provide a new model for studies of juvenile sarcomagenesis. Other appearance: Homozygous females are slightly undersized and underweight at 3-5 weeks of age.
Strain Development
Embryo injections were done using two guide RNAs to introduce deletions into exon 5 of Trp53, which encodes part of the DNA binding domain of p53. The target sequence for one guide RNA was GAAGTCACAGCACATGACGG (agg). The target sequence for the other guide RNA was CATCGGAGCAGCGCTCATGG (tgg). The two CRISPR guide RNAs and Cas9 mRNA were microinjected into the cytoplasm of FVB zygotes. Progeny were screened by PCR amplification of tail DNA using primers 297 (ttgacacctgatcgttactcggct) and 298 (gaataagtcagaagccgggagatg) and sequencing of the PCR bands. One founder male with overlapping sequences was mated to an FVB female, and the F1 progeny were screened by PCR amplification using primers 297+298, followed by sequencing. Sibling F1 mice with identical deletions were mated to generate F2 mice. F2 mice were genotyped by PCR and sequencing. Homozygous F2 mutants showed a clean sequence with a 24-bp deletion. Homozygous brother/sister matings have been used to maintain the line. 100% of the mutant mice develop hemangiosarcomas by 10-14 weeks of age.

Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/NOve.
Suggested Control Mice
FVB/N

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Research Applications

  • Cancer

Strain Origin

Donor
Paul Overbeek, Ph.D., Baylor College of Medicine.

Colony and Husbandry Information

Special Considerations

Homozygous females must be mated before 7 weeks of age in order to be healthy enough to nurse the first litter of pups to weaning age.

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color
White
Eye
Pink

Breeding

MMRRC Breeding System
Sib-mating
Generation
F20
Overall Breeding Performance
Good

Reproductive Statistics

Viability and Fertility: Female Male Comments
Homozygotes are viable: Reduced Yes Some homozygous females die within 24 hours after birth; homozygous females and males develop hemangiomas by 12 weeks of age, so the females only live long enough to produce one litter.
Homozygotes are fertile: Yes Yes Some newborn lethality. Homozygous females need to begin mating by 6 weeks of age in order for them to be healthy enough to nurse their pups to weaning age.
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
5 to 9
Recommended wean age
3 weeks
Average Pups Weaned
5 to 9

Order Request Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
065575-MU-RESUS Litter recovered from cryo-archive $2,697.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.