Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
Embryo injections were done with one guide RNA. The target sequence for the guide RNA was ATAAGCCTGAAAATGTCTCC (tgg), which is located in exon 2 of Trp53. The following oligos were annealed to form the donor DNA:
Sense oligo: 5’-AGCCTCGAGCTCCCTCTGAGCCAGGAGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGACATTTTCAGGCTTATGGAAACTGT
Antisense oligo: 5’-ACAGTTTCCATAAGCCTGAAAATGTcgtagaatcgagaccgaggagagggttagggataggcttaccCTCCTGGCTCAGAGGGAGCTCGAGGCT
These oligos were designed to introduce an in-frame insertion of the coding sequences for the 14-amino-acid V5 epitope tag:
5'-ggt aag cct atc cct aac cct ctc ctc ggt ctc gat tct acg-3' (coding for GKPIPNPLLGLDST)
The CRISPR guide RNA, Cas9 protein, and donor DNA were microinjected into the pronucleus of FVB zygotes. Progeny were screened by PCR using primers 816 (gcttctgtcctccatgttcctg) and 818 (acagacacccaacaccataccat). PCR bands were sequenced to look for targeted integration of the donor DNA. One founder male was mated to FVB females, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 816+818. The PCR bands were sequenced. Sibling F1 mice with identical 42-bp insertions insertions were mated to generate F2 mice. The F2 mice were screened for homozygosity by PCR amplification and sequencing. Homozygous mice showed a clean sequence with the 42-bp insert. Homozygous brother/sister matings have been used to maintain the line.
Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/Ove.
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.