Strain Detail Sheet

Strain Name:
B6J.Cg-Tg(Pbsn-TMEFF2)478Mjre/Mmmh
Stock Number:
066707-MU
Citation ID:
RRID:MMRRC_066707-MU
Other Names:
PB-TMEFF2

Strain Information

Gene Details

Pbsn
Name: Probasin
Type: Gene
Species: Rattus norvegicus (norway rat)
Chromosome:
TMEFF2
Name: transmembrane protein with EGF like and two follistatin like domains 2
Type: Transgene
Species: Homo sapiens (human)
Chromosome: 2
Alteration at locus: Transgenic (random, gene disruption)
Tg(Pbsn-TMEFF2)478Mjre
Name: transgene insertion 478, Maria J Ruiz Echevaria
Type: Transgene
Species: Multi-species
Chromosome:
Alteration at locus: Transgenic (random, gene disruption)
Genetic Alterations
Human TMEFF2 gene expressed under control of the rat probasin promoter (luminal expression).

Strain Description

Phenotype
Abnormal prostate regeneration after castration. Some altered prostate metabolomics (metabolite analysis). The transgene is better transmitted to the progeny from the male.
MeSH Terms
  • Adenocarcinoma/metabolism
  • Adenocarcinoma/pathology
  • Animals
  • Carcinogenesis/metabolism
  • Cell Transformation, Neoplastic/metabolism
  • Disease Models, Animal
  • Immunohistochemistry
  • Male
  • Membrane Proteins/metabolism
  • Mice
  • Mice, Transgenic
  • Neoplasm Transplantation/pathology
  • Neoplasm Transplantation/physiology
  • Neuroendocrine Tumors/metabolism
  • Neuroendocrine Tumors/pathology
  • Prostate/pathology
  • Prostate/physiology
  • Prostatic Neoplasms/metabolism
  • Prostatic Neoplasms/pathology
  • Regeneration
  • Tumor Cells, Cultured
Strain Development
The transgene was injected into C57BL/6 x DBA2 embryos. Generation of litters led to two founder animals containing the transgene. These founders were identified by PCR genotyping of tail genomic DNA using the Terra PCR direct kit (Clontech Laboratories, Mountain View, CA) and the following primers: (sense 5′‐CAGGGCACTACAGTTCAGACA‐3′) or (sense 5′‐GGAATTGCTCTGGTTATGATG‐3′) and (antisense 5’-CAAATGTGGATAGGCTGATTATG-3’). The founder animals were then backcrossed to C57BL/6J mice (JAX Strain #000664) for at least seven-plus generations prior to being used for studies. Founder number 478 was selected for the main study and breeding.
Suggested Control Mice
Non transgenic males. In some instances, and depending on the experiment, the sisters can be used since they don't express the transgene.

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Research Applications

  • Cancer
  • Cell Biology
  • Developmental Biology

Strain Origin

Donor
Maria J Ruiz Echevaria, Ph.D., Oklahoma University Health Sciences Center.
Primary Reference

Corbin JM, Overcash RF, Wren JD, Coburn A, Tipton GJ, Ezzell JA, McNaughtonKK, Fung KM, Kosanke SD, Ruiz-Echevarria MJ. Analysis of TMEFF2 allografts andtransgenic mouse models reveals roles in prostate regeneration and cancer.Prostate. 2016 Jan;76(1):97-113. doi: 10.1002/pros.23103. Epub 2015 Sep 29.(Medline PMID: 26417683)

Colony and Husbandry Information

Special Considerations

The transgene is better transmitted to the progeny from the male.

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Sib-Mating and Backcross
Generation
N7+ (C57BL/6J)

Per the Donor - "The strain was maintained on a scheme involving mating of transgene positive males with transgene negative females (although some positive-positive crosses were also conducted, the litters were smaller -- although we did not conduct a rigorous analysis of this fact). In addition, since its initial development, the strain has gone through many different backcrosses to the parental strain to avoid problems derived from sibling mating."
Overall Breeding Performance
Good

Reproductive Statistics

NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Hetero/Hemizygotes are fertile: Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
7 to 9
Recommended wean age
3 Weeks
Average Pups Weaned
7 to 9

Order Request Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.