Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8025Btlr/Mmmh
Stock Number:
067464-MU
Citation ID:
RRID:MMRRC_067464-MU
Other Names:
R8025 (G1)
Major Collection:

Strain Information

Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Tead3
Name: TEA domain family member 3
Synonyms: ETFR-1, TEAD-3, DTEF-1, Tcf13r2, TEF-5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21678
Homologene: 81821
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, PDZ-RGS3, C2pa, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Polr1c
Name: polymerase (RNA) I polypeptide C
Synonyms: RPA40, 40kDa, Rpo1-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20016
Homologene: 3586
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Bzw2
Name: basic leucine zipper and W2 domains 2
Synonyms: HSPC028, 1110001I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66912
VEGA: 12
Homologene: 8530
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71544
Homologene: 28446
Aip
Name: aryl-hydrocarbon receptor-interacting protein
Synonyms: Ara9, Xap2, D19Bwg1412e, Fkbp16
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11632
HGNC: HGNC:358
Homologene: 2959
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Pcbp2
Name: poly(rC) binding protein 2
Synonyms: alphaCP-2, Hnrpx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18521
VEGA: 15
HGNC: HGNC:8648
Homologene: 74536
Dennd1b
Name: DENN domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329260
Homologene: 11739
Tceanc2
Name: transcription elongation factor A (SII) N-terminal and central domain containing 2
Synonyms: 2210010B22Rik, 6330404A07Rik, 2210012G02Rik, Tdeanc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66526
Homologene: 11984
Dhx32
Name: DEAH-box helicase 32 (putative)
Synonyms: Ddx32, DEAH (Asp-Glu-Ala-His) box polypeptide 32
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101437
Homologene: 56798
4930579G24Rik
Name: RIKEN cDNA 4930579G24 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75939
Homologene: 37198
Recql5
Name: RecQ protein-like 5
Synonyms: Recql5b, Recq5b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170472
HGNC: HGNC:9950
Homologene: 31232
Itih5
Name: inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms: 5430408M01Rik, 4631408O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209378
Homologene: 57115
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59090
Homologene: 32510
Dync2i2
Name: dynein 2 intermediate chain 2
Synonyms: 3200002I06Rik, Wdr34
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71820
Homologene: 14156
Raver2
Name: ribonucleoprotein, PTB-binding 2
Synonyms: A430091O22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242570
Homologene: 18829
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546144
Homologene: 52326
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269902
Homologene: 104832
Cngb3
Name: cyclic nucleotide gated channel beta 3
Synonyms: CNG6, CCNC2, Cngbeta2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30952
HGNC: HGNC:2153
Homologene: 40908
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Or7e175
Name: olfactory receptor family 7 subfamily E member 175
Synonyms: GA_x6K02T2PVTD-13878275-13879204, MOR145-6, Olfr869
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258550
HGNC: HGNC:8396
Homologene: 138312
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Or2d36
Name: olfactory receptor family 2 subfamily D member 36
Synonyms: GA_x6K02T2PBJ9-9497411-9498355, MOR260-2, Olfr716
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258597
Homologene: 121514
Mcrs1
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Parpbp
Name: PARP1 binding protein
Synonyms: 4930547N16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75317
Homologene: 49519
Sdcbp
Name: syndecan binding protein
Synonyms: syntenin, syndecan interacting protein, Sycl, MDA-9, syntenin-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53378
Homologene: 4110
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Or51f5
Name: olfactory receptor family 51 subfamily F member 5
Synonyms: GA_x6K02T2PBJ9-5491151-5492095, MOR14-2, Olfr561
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259096
Homologene: 133029
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Actl7b
Name: actin-like 7b
Synonyms: Tact1, t-actin 1, ENSMUSG00000070980
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11471
HGNC: HGNC:162
Homologene: 21330
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102448
VEGA: 9
Homologene: 3746
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Gm57858
Name: gene model 57858
Synonyms: Ccdc144b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241943
Homologene: 87263
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Rec114
Name: REC114 meiotic recombination protein
Synonyms: 4930527A11Rik, 2410076I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73673
Homologene: 83546
Or5m11
Name: olfactory receptor family 5 subfamily M member 11
Synonyms: GA_x6K02T2Q125-47430129-47431103, MOR198-3P, MOR198-4, MOR198-6_p, MOR198-3P, Olfr1534-ps1, Olfr1028
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257936
Homologene: 73972
Rnf148
Name: ring finger protein 148
Synonyms: Greul3, 4933432M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71300
Homologene: 82404
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
Kcns3
Name: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms: D12Ertd137e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238076
VEGA: 12
HGNC: HGNC:6302
Homologene: 20518
Or4d2b
Name: olfactory receptor family 4 subfamily D member 2B
Synonyms: GA_x6K02T2PAEV-9536824-9535889, MOR240-3, Olfr462
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258406
HGNC: HGNC:8294
Homologene: 64870
Sult1c2
Name: sulfotransferase family, cytosolic, 1C, member 2
Synonyms: ST1C1, 1810008N17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69083
Homologene: 38201
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107239
VEGA: 19
Homologene: 26439
Rasl2-9
Name: RAS-like, family 2, locus 9
Synonyms: Ran/M2, Rasl2-9-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19428
Homologene: 135303
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Vmn1r188
Name: vomeronasal 1 receptor 188
Synonyms: V1rh17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252912
Homologene: 110880
Rbpjl
Name: recombination signal binding protein for immunoglobulin kappa J region-like
Synonyms: RBP-J kappa-like, RBP-L, Rbpsuhl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19668
Homologene: 7512
Habp4
Name: hyaluronic acid binding protein 4
Synonyms: 4933413D03Rik, 4933428J01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56541
VEGA: 13
Homologene: 8615
Pcdhgc5
Name: protocadherin gamma subfamily C, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93708
HGNC: HGNC:8718
Homologene: 110933
AL732309.1
Name:
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 46,457,296 bp
  • A to G, chromosome 1 at 139,110,420 bp
  • G to A, chromosome 2 at 10,241,022 bp
  • A to G, chromosome 2 at 25,246,319 bp
  • T to C, chromosome 2 at 30,048,718 bp
  • T to C, chromosome 2 at 66,318,213 bp
  • A to T, chromosome 2 at 85,951,512 bp
  • C to A, chromosome 2 at 164,410,246 bp
  • T to C, chromosome 2 at 177,086,456 bp
  • C to A, chromosome 3 at 36,018,987 bp
  • A to G, chromosome 3 at 64,275,450 bp
  • T to G, chromosome 3 at 79,629,328 bp
  • A to T, chromosome 3 at 89,761,342 bp
  • A to G, chromosome 3 at 117,832,877 bp
  • A to G, chromosome 4 at 6,393,022 bp
  • A to T, chromosome 4 at 19,280,960 bp
  • T to C, chromosome 4 at 56,741,137 bp
  • C to A, chromosome 4 at 62,690,594 bp
  • C to A, chromosome 4 at 101,102,965 bp
  • C to T, chromosome 4 at 107,139,800 bp
  • T to C, chromosome 5 at 114,408,209 bp
  • T to C, chromosome 5 at 123,558,675 bp
  • C to T, chromosome 5 at 137,406,352 bp
  • C to T, chromosome 6 at 23,654,197 bp
  • G to A, chromosome 6 at 89,331,272 bp
  • A to G, chromosome 7 at 5,125,482 bp
  • T to A, chromosome 7 at 30,056,853 bp
  • A to G, chromosome 7 at 41,426,759 bp
  • A to T, chromosome 7 at 80,290,346 bp
  • T to C, chromosome 7 at 102,775,256 bp
  • A to G, chromosome 7 at 107,147,723 bp
  • G to A, chromosome 7 at 118,206,989 bp
  • A to G, chromosome 7 at 133,721,371 bp
  • A to G, chromosome 8 at 94,392,521 bp
  • T to G, chromosome 9 at 9,005,822 bp
  • T to C, chromosome 9 at 20,137,632 bp
  • T to A, chromosome 9 at 43,111,553 bp
  • T to G, chromosome 9 at 58,660,322 bp
  • T to A, chromosome 9 at 74,143,499 bp
  • T to C, chromosome 9 at 119,381,503 bp
  • G to A, chromosome 10 at 80,155,292 bp
  • T to C, chromosome 10 at 88,093,108 bp
  • A to T, chromosome 11 at 87,888,951 bp
  • C to A, chromosome 11 at 115,928,112 bp
  • A to T, chromosome 12 at 11,091,845 bp
  • T to C, chromosome 12 at 36,107,518 bp
  • A to T, chromosome 12 at 54,909,136 bp
  • T to C, chromosome 13 at 22,087,914 bp
  • G to A, chromosome 13 at 64,174,831 bp
  • A to G, chromosome 15 at 32,548,782 bp
  • G to A, chromosome 15 at 99,246,933 bp
  • T to A, chromosome 15 at 102,488,276 bp
  • T to C, chromosome 17 at 26,204,385 bp
  • T to C, chromosome 17 at 28,335,035 bp
  • T to A, chromosome 17 at 30,741,337 bp
  • GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA to GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA, chromosome 17 at 35,620,987 bp
  • A to G, chromosome 17 at 46,245,048 bp
  • A to T, chromosome 17 at 53,831,809 bp
  • A to T, chromosome 18 at 7,127,224 bp
  • T to C, chromosome 18 at 37,820,939 bp
  • G to T, chromosome 18 at 62,936,908 bp
  • C to A, chromosome 19 at 4,115,346 bp
  • A to T, chromosome 19 at 4,166,506 bp
  • T to A, chromosome 19 at 17,561,051 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8025 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067464-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.