Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8446Btlr/Mmmh
Stock Number:
067827-MU
Citation ID:
RRID:MMRRC_067827-MU
Other Names:
R8446 (G1)
Major Collection:

Strain Information

Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Wfs1
Name: wolframin ER transmembrane glycoprotein
Synonyms: wolframin, Wolfram syndrome 1 homolog (human)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22393
Homologene: 4380
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Larp1
Name: La ribonucleoprotein 1, translational regulator
Synonyms: Larp, 1810024J12Rik, 3110040D16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73158
Homologene: 9089
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Tmem245
Name: transmembrane protein 245
Synonyms: A630051L19Rik, D730040F13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242474
HGNC: HGNC:1363
Homologene: 41841
Ddias
Name: DNA damage-induced apoptosis suppressor
Synonyms: noxin, 4632434I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74041
Homologene: 51655
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380969
Homologene: 18924
Afap1
Name: actin filament associated protein 1
Synonyms: 9630044L16Rik, 2600003E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70292
Homologene: 11009
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Slc6a3
Name: solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Synonyms: DAT, Dat1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13162
VEGA: 13
Homologene: 55547
Csgalnact1
Name: chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms: CSGalNAcT-1, 4732435N03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234356
Homologene: 23099
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Pdgfa
Name: platelet derived growth factor, alpha
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18590
HGNC: HGNC:8799
Homologene: 32055
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Rpf2
Name: ribosome production factor 2 homolog
Synonyms: 2810470K21Rik, Bxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67239
Homologene: 6404
Tinagl1
Name: tubulointerstitial nephritis antigen-like 1
Synonyms: 1110021J17Rik, androgen-regulated gene 1, Arg1, Lcn7, AZ-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 94242
Homologene: 41472
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Cxxc8, Fbl7, lalina, Jhdm1a, Fbxl11, Gm4560, 5530401A10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225876
Homologene: 56564
Sox17
Name: SRY (sex determining region Y)-box 17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20671
Homologene: 7948
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Bbs1
Name: Bardet-Biedl syndrome 1
Synonyms: D19Ertd609e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52028
VEGA: 19
HGNC: HGNC:966
Homologene: 11641
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Itgb2l
Name: integrin beta 2-like
Synonyms: pactolus, 5033406G21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16415
HGNC: HGNC:6155
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Or2j3
Name: olfactory receptor family 2 subfamily J member 3
Synonyms: MOR256-18, GA_x6K02T2PSCP-2749525-2748587, Olfr137
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258481
Homologene: 128084
Trim67
Name: tripartite motif-containing 67
Synonyms: D130049O21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330863
Homologene: 45699
Capn2
Name: calpain 2
Synonyms: m-calpain, Capa-2, Capa2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12334
HGNC: HGNC:1479
Homologene: 1326
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Or8b46
Name: olfactory receptor family 8 subfamily B member 46
Synonyms: GA_x6K02T2PVTD-32239063-32239995, MOR165-3, Olfr910
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258807
VEGA: 9
Homologene: 115510
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: M3R, Chrm-3, muscarinic acetylcholine receptor 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Camk4
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: Ca2+/calmodulin-dependent protein kinase type IV/Gr, CaMKIV/Gr, CaMKIV, A430110E23Rik, D18Bwg0362e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12326
VEGA: 18
HGNC: HGNC:1464
Homologene: 100780
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, restin, Clip 170
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12722
HGNC: HGNC:2017
Homologene: 77224
Zfp763
Name: zinc finger protein 763
Synonyms: 1700065O13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73451
Homologene: 66274
Slc35c1
Name: solute carrier family 35, member C1
Synonyms: FUCT1, E430007K15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228368
Homologene: 41258
Tex44
Name: testis expressed 44
Synonyms: 1700019O17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71863
Homologene: 51874
Commd5
Name: COMM domain containing 5
Synonyms: 2310065H03Rik, Hcarg, D15Ertd81e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66398
Homologene: 8548
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Prl3d2
Name: prolactin family 3, subfamily d, member 2
Synonyms: PL-Ib, Plib
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 215028
Homologene: 137215
Krtap5-2
Name: keratin associated protein 5-2
Synonyms: 4833428E21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71623
Igkv8-27
Name: immunoglobulin kappa chain variable 8-27
Synonyms: Gm16944
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434041
HGNC: HGNC:5834
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,492,093 bp
  • A to T, chromosome 1 at 46,290,715 bp
  • A to T, chromosome 1 at 86,426,974 bp
  • T to C, chromosome 1 at 87,978,468 bp
  • A to T, chromosome 1 at 182,484,231 bp
  • A to C, chromosome 2 at 76,948,209 bp
  • T to A, chromosome 2 at 92,454,362 bp
  • TG to T, chromosome 3 at 95,474,703 bp
  • A to T, chromosome 3 at 144,748,487 bp
  • T to C, chromosome 4 at 56,906,261 bp
  • T to A, chromosome 4 at 66,839,436 bp
  • C to T, chromosome 4 at 130,166,901 bp
  • G to A, chromosome 5 at 24,566,643 bp
  • A to T, chromosome 5 at 33,901,638 bp
  • T to A, chromosome 5 at 35,987,301 bp
  • A to T, chromosome 5 at 36,971,609 bp
  • G to C, chromosome 5 at 123,655,945 bp
  • T to C, chromosome 5 at 138,978,640 bp
  • A to G, chromosome 5 at 147,033,359 bp
  • A to G, chromosome 6 at 70,171,948 bp
  • A to T, chromosome 6 at 118,627,450 bp
  • C to A, chromosome 7 at 92,866,610 bp
  • TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA to TCCACAGGAACTACA, chromosome 7 at 142,175,108 bp
  • G to A, chromosome 8 at 40,606,884 bp
  • A to G, chromosome 8 at 68,461,091 bp
  • G to T, chromosome 8 at 124,793,991 bp
  • A to T, chromosome 9 at 38,539,668 bp
  • T to A, chromosome 9 at 103,308,862 bp
  • T to A, chromosome 10 at 40,239,756 bp
  • T to C, chromosome 11 at 58,051,209 bp
  • T to A, chromosome 11 at 67,253,521 bp
  • C to T, chromosome 13 at 9,878,302 bp
  • A to T, chromosome 13 at 27,123,993 bp
  • A to T, chromosome 13 at 73,571,555 bp
  • A to G, chromosome 13 at 93,093,828 bp
  • T to C, chromosome 15 at 76,900,894 bp
  • C to T, chromosome 15 at 78,994,126 bp
  • C to A, chromosome 15 at 99,426,049 bp
  • T to G, chromosome 15 at 99,947,454 bp
  • T to C, chromosome 15 at 102,218,608 bp
  • G to T, chromosome 16 at 96,432,657 bp
  • A to T, chromosome 17 at 33,019,499 bp
  • A to G, chromosome 17 at 38,304,747 bp
  • T to A, chromosome 18 at 33,156,757 bp
  • C to T, chromosome 18 at 78,857,756 bp
  • G to A, chromosome 19 at 4,356,888 bp
  • G to A, chromosome 19 at 4,897,605 bp
  • T to C, chromosome 19 at 40,326,158 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8446 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067827-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.