Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8446Btlr/Mmmh
Stock Number:
067827-MU
Citation ID:
RRID:MMRRC_067827-MU
Other Names:
R8446 (G1)
Major Collection:

Strain Information

Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Wfs1
Name: wolframin ER transmembrane glycoprotein
Synonyms: wolframin, Wolfram syndrome 1 homolog (human)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22393
Homologene: 4380
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Larp1
Name: La ribonucleoprotein 1, translational regulator
Synonyms: Larp, 1810024J12Rik, 3110040D16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73158
Homologene: 9089
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Tmem245
Name: transmembrane protein 245
Synonyms: A630051L19Rik, D730040F13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242474
HGNC: HGNC:1363
Homologene: 41841
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,492,093 bp
  • A to T, chromosome 1 at 46,290,715 bp
  • A to T, chromosome 1 at 86,426,974 bp
  • T to C, chromosome 1 at 87,978,468 bp
  • A to T, chromosome 1 at 182,484,231 bp
  • A to C, chromosome 2 at 76,948,209 bp
  • T to A, chromosome 2 at 92,454,362 bp
  • TG to T, chromosome 3 at 95,474,703 bp
  • A to T, chromosome 3 at 144,748,487 bp
  • T to C, chromosome 4 at 56,906,261 bp
  • T to A, chromosome 4 at 66,839,436 bp
  • C to T, chromosome 4 at 130,166,901 bp
  • G to A, chromosome 5 at 24,566,643 bp
  • A to T, chromosome 5 at 33,901,638 bp
  • T to A, chromosome 5 at 35,987,301 bp
  • A to T, chromosome 5 at 36,971,609 bp
  • G to C, chromosome 5 at 123,655,945 bp
  • T to C, chromosome 5 at 138,978,640 bp
  • A to G, chromosome 5 at 147,033,359 bp
  • A to G, chromosome 6 at 70,171,948 bp
  • A to T, chromosome 6 at 118,627,450 bp
  • C to A, chromosome 7 at 92,866,610 bp
  • TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA to TCCACAGGAACTACA, chromosome 7 at 142,175,108 bp
  • G to A, chromosome 8 at 40,606,884 bp
  • A to G, chromosome 8 at 68,461,091 bp
  • G to T, chromosome 8 at 124,793,991 bp
  • A to T, chromosome 9 at 38,539,668 bp
  • T to A, chromosome 9 at 103,308,862 bp
  • T to A, chromosome 10 at 40,239,756 bp
  • T to C, chromosome 11 at 58,051,209 bp
  • T to A, chromosome 11 at 67,253,521 bp
  • C to T, chromosome 13 at 9,878,302 bp
  • A to T, chromosome 13 at 27,123,993 bp
  • A to T, chromosome 13 at 73,571,555 bp
  • A to G, chromosome 13 at 93,093,828 bp
  • T to C, chromosome 15 at 76,900,894 bp
  • C to T, chromosome 15 at 78,994,126 bp
  • C to A, chromosome 15 at 99,426,049 bp
  • T to G, chromosome 15 at 99,947,454 bp
  • T to C, chromosome 15 at 102,218,608 bp
  • G to T, chromosome 16 at 96,432,657 bp
  • A to T, chromosome 17 at 33,019,499 bp
  • A to G, chromosome 17 at 38,304,747 bp
  • T to A, chromosome 18 at 33,156,757 bp
  • C to T, chromosome 18 at 78,857,756 bp
  • G to A, chromosome 19 at 4,356,888 bp
  • G to A, chromosome 19 at 4,897,605 bp
  • T to C, chromosome 19 at 40,326,158 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8446 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067827-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.