Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8860Btlr/Mmmh
Stock Number:
068678-MU
Citation ID:
RRID:MMRRC_068678-MU
Other Names:
R8860 (G1)
Major Collection:

Strain Information

Gga3
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms: C230037M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 260302
Homologene: 121703
Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: Chuk1, IKK1, IKK[a], IKK-alpha, IkappaB kinase alpha, IKK 1, IKK alpha, IKKalpha, IKK-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Atf6
Name: activating transcription factor 6
Synonyms: ESTM49, 9130025P16Rik, Atf6alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,136,419 bp
  • A to G, chromosome 1 at 106,782,684 bp
  • G to A, chromosome 1 at 153,821,354 bp
  • A to T, chromosome 1 at 170,852,966 bp
  • A to G, chromosome 2 at 6,560,657 bp
  • A to T, chromosome 3 at 38,892,120 bp
  • G to A, chromosome 3 at 40,672,732 bp
  • A to G, chromosome 3 at 97,570,369 bp
  • T to A, chromosome 4 at 125,086,197 bp
  • A to T, chromosome 4 at 126,493,250 bp
  • T to A, chromosome 4 at 147,866,382 bp
  • T to C, chromosome 5 at 104,093,352 bp
  • A to G, chromosome 6 at 143,083,220 bp
  • A to G, chromosome 7 at 5,059,571 bp
  • A to T, chromosome 7 at 17,040,987 bp
  • T to A, chromosome 7 at 42,142,230 bp
  • A to T, chromosome 7 at 80,494,528 bp
  • A to T, chromosome 7 at 85,872,941 bp
  • A to G, chromosome 7 at 102,909,129 bp
  • A to G, chromosome 8 at 70,388,155 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to T, chromosome 8 at 109,562,729 bp
  • A to C, chromosome 9 at 20,822,725 bp
  • A to T, chromosome 9 at 25,252,684 bp
  • C to T, chromosome 10 at 58,408,103 bp
  • T to A, chromosome 11 at 50,815,192 bp
  • C to T, chromosome 11 at 58,684,140 bp
  • C to T, chromosome 11 at 59,007,614 bp
  • T to A, chromosome 11 at 67,241,509 bp
  • T to A, chromosome 11 at 97,685,877 bp
  • T to C, chromosome 11 at 115,590,418 bp
  • T to G, chromosome 12 at 71,184,423 bp
  • T to A, chromosome 12 at 76,888,052 bp
  • T to A, chromosome 13 at 74,361,289 bp
  • T to C, chromosome 13 at 119,339,871 bp
  • T to C, chromosome 14 at 12,213,685 bp
  • A to G, chromosome 14 at 52,018,846 bp
  • A to G, chromosome 14 at 52,075,335 bp
  • G to T, chromosome 14 at 55,973,117 bp
  • A to T, chromosome 14 at 122,476,118 bp
  • T to C, chromosome 15 at 8,130,156 bp
  • T to G, chromosome 15 at 89,573,854 bp
  • A to T, chromosome 19 at 4,267,964 bp
  • A to G, chromosome 19 at 44,087,968 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8860 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068678-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.