Strain Name:
C57BL/6J-MtgxR8906Btlr/Mmmh
Stock Number:
068699-MU
Citation ID:
RRID:MMRRC_068699-MU
Other Names:
R8906 (G1)
Major Collection:

Strain Information

Fga
Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
HGNC: HGNC:3661
Homologene: 428
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Dhx35
Name: DEAH-box helicase 35
Synonyms: Ddx35, 1200009D07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Mob2
Name: MOB kinase activator 2
Synonyms: 1110017M21Rik, 2700078K21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101513
Homologene: 12477
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Fbxo28
Name: F-box protein 28
Synonyms: 5730505P19Rik, 4833428J17Rik, Fbx28, D1Ertd578e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67948
Homologene: 9050
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Nomo1
Name: nodal modulator 1
Synonyms: PM5, Nomo, D7Ertd156e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211548
Homologene: 13810
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Yars1
Name: tyrosyl-tRNA synthetase 1
Synonyms: Yars
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107271
Homologene: 2730
Rara
Name: retinoic acid receptor, alpha
Synonyms: RARalpha1, RAR alpha 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19401
HGNC: HGNC:9864
Homologene: 20262
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50883
Homologene: 38289
Dgkd
Name: diacylglycerol kinase, delta
Synonyms: DGKdelta, dgkd-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227333
HGNC: HGNC:2851
Homologene: 100054
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: ST8SiaV, Siat8e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225742
Homologene: 8331
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Crispld1
Name: cysteine-rich secretory protein LCCL domain containing 1
Synonyms: Cocoacrisp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 83691
Homologene: 12857
Hadh
Name: hydroxyacyl-Coenzyme A dehydrogenase
Synonyms: Hadhsc, Schad
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15107
HGNC: HGNC:4799
Homologene: 55888
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Cops7a
Name: COP9 signalosome subunit 7A
Synonyms: COP9 complex S7a, D6Ertd35e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26894
Homologene: 22685
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Slitrk1
Name: SLIT and NTRK-like family, member 1
Synonyms: 3200001I04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76965
VEGA: 14
Homologene: 14174
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: Cox-2, cyclooxygenase 2, Pghs2, COX2, prostaglandin G/H synthase, PHS-2, cyclooxygenase-2, PGHS-2, Tis10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Lrrc4c
Name: leucine rich repeat containing 4C
Synonyms: 6430556C10Rik, netrin g1 ligand, NGL-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241568
Homologene: 18696
Tns2
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Enkur
Name: enkurin, TRPC channel interacting protein
Synonyms: 4933434I06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71233
Homologene: 17022
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f, Myhs-f2, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Micalcl
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224552
Homologene: 115024
Smcp
Name: sperm mitochondria-associated cysteine-rich protein
Synonyms: Mcsp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17235
HGNC: HGNC:6962
Ppm1h
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: ARHCL1, A430075L18Rik, C030002B11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319468
Homologene: 18537
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: Great, LGR8, Gpr106
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
Usp43
Name: ubiquitin specific peptidase 43
Synonyms: C630032K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216835
Homologene: 129879
Barhl2
Name: BarH like homeobox 2
Synonyms: MBH1, E130309B19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 104382
HGNC: HGNC:954
Homologene: 10572
Galnt6
Name: polypeptide N-acetylgalactosaminyltransferase 6
Synonyms: GalNAc-T6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207839
HGNC: HGNC:4128
Homologene: 5218
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Or1j19
Name: olfactory receptor family 1 subfamily J member 19
Synonyms: GA_x6K02T2NLDC-33481050-33481991, MOR136-8, Olfr348
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258946
HGNC: HGNC:8209
Homologene: 105219
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, Nalp4e, 4930406H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Zer1
Name: zyg-11 related, cell cycle regulator
Synonyms: C230075L19Rik, Zyg11bl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227693
Homologene: 4621
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, T1r2, Gpr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Or10j5
Name: olfactory receptor family 10 subfamily J member 5
Synonyms: MOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228, Olfr16
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18313
Homologene: 7460
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: GA_x6K02T2PMLR-6121675-6122604, MOR106-2, Olfr739
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258663
Homologene: 121549
H2-M11
Name: histocompatibility 2, M region locus 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224754
Homologene: 52241
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208076
Homologene: 32527
Vmn1r236
Name: vomeronasal 1 receptor 236
Synonyms: V1rf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171235
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Nkx2-6
Name: NK2 homeobox 6
Synonyms: Tix, Nkx2.6, tinman, Nkx-2.6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18092
Homologene: 22604
Adad2
Name: adenosine deaminase domain containing 2
Synonyms: 4930403J07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75773
Homologene: 16392
Cd200r3
Name: CD200 receptor 3
Synonyms: 4733401I18Rik, mCD200RLb, 4833409J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74603
Rasa4
Name: RAS p21 protein activator 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54153
Homologene: 5080
Ppp2r2b
Name: protein phosphatase 2, regulatory subunit B, beta
Synonyms: 6330404L05Rik, PP2A-PR55B, PR55-BETA, SCA12, 2900026H06Rik, E130009M08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72930
HGNC: HGNC:9305
Homologene: 55833
1810055G02Rik
Name: RIKEN cDNA 1810055G02 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72056
VEGA: 19
HGNC: HGNC:1174
Homologene: 11174
Gm572
Name: predicted gene 572
Synonyms: LOC230909, b2b1167Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230909
Homologene: 52134
Slc26a10
Name: solute carrier family 26, member 10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216441
VEGA: 10
Homologene: 66953
Gpr84
Name: G protein-coupled receptor 84
Synonyms: EX33
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 80910
VEGA: 15
HGNC: HGNC:4535
Homologene: 41370
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
Scn4b
Name: sodium channel, type IV, beta
Synonyms: LOC384934
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 399548
Homologene: 18384
2510009E07Rik
Name: RIKEN cDNA 2510009E07 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72190
VEGA: 16
Homologene: 78167
Gpatch11
Name: G patch domain containing 11
Synonyms: 2310002B06Rik, Ccdc75
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53951
VEGA: 17
Homologene: 44687
Hoxd13
Name: homeobox D13
Synonyms: Hox-4.8, spdh
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15433
HGNC: HGNC:5136
Homologene: 20147
Cdc34b
Name: cell division cycle 34B
Synonyms: Cdc34-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 111266
HGNC: HGNC:1734
Lysmd1
Name: LysM, putative peptidoglycan-binding, domain containing 1
Synonyms: 2610022K04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 217779
Homologene: 41742
Scrn3
Name: secernin 3
Synonyms: 4833415E20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74616
Homologene: 11601
Or8g22
Name: olfactory receptor family 8 subfamily G member 22, pseudogene 1
Synonyms: GA_x6K02T2PVTD-32743332-32742397, MOR171-37, EG628171, Olfr936
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100503486
VEGA: 9
Prr18
Name: proline rich 18
Synonyms: 9630019K15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320111
VEGA: 17
Homologene: 52195
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 17,750,771 bp
  • A to G, chromosome 1 at 87,697,615 bp
  • A to G, chromosome 1 at 87,941,435 bp
  • A to T, chromosome 1 at 135,254,940 bp
  • A to C, chromosome 1 at 135,394,213 bp
  • A to G, chromosome 1 at 150,104,108 bp
  • G to A, chromosome 1 at 166,146,647 bp
  • A to G, chromosome 1 at 172,956,619 bp
  • A to T, chromosome 1 at 182,317,069 bp
  • A to T, chromosome 2 at 17,378,117 bp
  • A to G, chromosome 2 at 21,196,757 bp
  • G to A, chromosome 2 at 30,111,023 bp
  • A to T, chromosome 2 at 36,786,609 bp
  • T to C, chromosome 2 at 52,206,247 bp
  • A to G, chromosome 2 at 68,732,154 bp
  • G to A, chromosome 2 at 73,331,008 bp
  • C to A, chromosome 2 at 73,331,011 bp
  • A to G, chromosome 2 at 74,669,922 bp
  • T to C, chromosome 2 at 97,630,048 bp
  • A to G, chromosome 2 at 158,806,998 bp
  • C to T, chromosome 3 at 59,326,318 bp
  • C to A, chromosome 3 at 83,031,804 bp
  • T to A, chromosome 3 at 92,584,223 bp
  • A to G, chromosome 3 at 95,137,908 bp
  • A to G, chromosome 3 at 126,933,071 bp
  • T to C, chromosome 3 at 131,245,242 bp
  • T to C, chromosome 4 at 28,821,615 bp
  • G to A, chromosome 4 at 41,625,125 bp
  • A to C, chromosome 4 at 129,196,954 bp
  • A to G, chromosome 4 at 139,669,735 bp
  • A to G, chromosome 4 at 148,666,833 bp
  • A to G, chromosome 5 at 57,721,812 bp
  • G to A, chromosome 5 at 89,677,716 bp
  • G to T, chromosome 5 at 94,683,554 bp
  • G to A, chromosome 5 at 106,455,486 bp
  • A to G, chromosome 5 at 110,865,592 bp
  • A to G, chromosome 5 at 114,801,737 bp
  • T to A, chromosome 5 at 136,104,592 bp
  • A to T, chromosome 5 at 150,066,423 bp
  • T to A, chromosome 6 at 61,810,858 bp
  • T to C, chromosome 6 at 124,962,408 bp
  • A to G, chromosome 7 at 23,321,131 bp
  • A to T, chromosome 7 at 46,072,580 bp
  • T to A, chromosome 7 at 112,381,464 bp
  • A to G, chromosome 7 at 126,471,120 bp
  • A to T, chromosome 7 at 142,009,524 bp
  • A to G, chromosome 8 at 61,550,164 bp
  • G to A, chromosome 8 at 70,334,165 bp
  • T to C, chromosome 8 at 91,800,287 bp
  • A to T, chromosome 8 at 95,263,108 bp
  • C to A, chromosome 8 at 119,612,986 bp
  • G to A, chromosome 9 at 36,892,871 bp
  • A to G, chromosome 9 at 39,046,781 bp
  • A to G, chromosome 9 at 45,147,871 bp
  • G to T, chromosome 9 at 85,743,404 bp
  • G to T, chromosome 9 at 108,107,553 bp
  • T to C, chromosome 10 at 82,286,545 bp
  • C to T, chromosome 10 at 122,878,546 bp
  • T to C, chromosome 10 at 127,180,590 bp
  • A to G, chromosome 11 at 16,911,635 bp
  • A to G, chromosome 11 at 67,205,913 bp
  • A to T, chromosome 11 at 67,891,481 bp
  • A to C, chromosome 11 at 94,742,085 bp
  • G to T, chromosome 11 at 98,970,163 bp
  • C to A, chromosome 12 at 101,520,645 bp
  • A to G, chromosome 13 at 46,773,678 bp
  • T to A, chromosome 13 at 49,728,701 bp
  • T to G, chromosome 14 at 50,424,834 bp
  • T to C, chromosome 14 at 69,175,174 bp
  • T to C, chromosome 14 at 79,092,375 bp
  • A to G, chromosome 14 at 108,911,707 bp
  • T to A, chromosome 15 at 66,532,757 bp
  • C to T, chromosome 15 at 68,084,555 bp
  • T to C, chromosome 15 at 100,703,366 bp
  • T to C, chromosome 15 at 102,111,604 bp
  • T to A, chromosome 15 at 103,309,198 bp
  • CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA to CCGGA, chromosome 16 at 21,653,398 bp
  • A to T, chromosome 16 at 37,208,164 bp
  • G to A, chromosome 16 at 44,503,568 bp
  • A to T, chromosome 16 at 44,957,739 bp
  • G to A, chromosome 17 at 8,341,644 bp
  • T to A, chromosome 17 at 19,066,270 bp
  • T to A, chromosome 17 at 21,287,094 bp
  • T to A, chromosome 17 at 36,548,959 bp
  • C to T, chromosome 17 at 78,837,860 bp
  • C to T, chromosome 18 at 42,688,334 bp
  • G to A, chromosome 18 at 77,248,476 bp
  • A to C, chromosome 19 at 3,716,686 bp
  • T to A, chromosome 19 at 43,890,242 bp
  • T to A, chromosome 19 at 56,842,713 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8906 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068699-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.