Loading...

Strain Detail Sheet

Strain Name:
C57BL/6J-MtgxR8906Btlr/Mmmh
Stock Number:
068699-MU
Citation ID:
RRID:MMRRC_068699-MU
Other Names:
R8906 (G1)
Major Collection:
Beutler Mutagenetix

Strain Information

Gene Details

Fga
Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
HGNC: HGNC:3661
Homologene: 428

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 17,750,771 bp
  • A to G, chromosome 1 at 87,697,615 bp
  • A to G, chromosome 1 at 87,941,435 bp
  • A to T, chromosome 1 at 135,254,940 bp
  • A to C, chromosome 1 at 135,394,213 bp
  • A to G, chromosome 1 at 150,104,108 bp
  • G to A, chromosome 1 at 166,146,647 bp
  • A to G, chromosome 1 at 172,956,619 bp
  • A to T, chromosome 1 at 182,317,069 bp
  • A to T, chromosome 2 at 17,378,117 bp
  • A to G, chromosome 2 at 21,196,757 bp
  • G to A, chromosome 2 at 30,111,023 bp
  • A to T, chromosome 2 at 36,786,609 bp
  • T to C, chromosome 2 at 52,206,247 bp
  • A to G, chromosome 2 at 68,732,154 bp
  • G to A, chromosome 2 at 73,331,008 bp
  • C to A, chromosome 2 at 73,331,011 bp
  • A to G, chromosome 2 at 74,669,922 bp
  • T to C, chromosome 2 at 97,630,048 bp
  • A to G, chromosome 2 at 158,806,998 bp
  • C to T, chromosome 3 at 59,326,318 bp
  • C to A, chromosome 3 at 83,031,804 bp
  • T to A, chromosome 3 at 92,584,223 bp
  • A to G, chromosome 3 at 95,137,908 bp
  • A to G, chromosome 3 at 126,933,071 bp
  • T to C, chromosome 3 at 131,245,242 bp
  • T to C, chromosome 4 at 28,821,615 bp
  • G to A, chromosome 4 at 41,625,125 bp
  • A to C, chromosome 4 at 129,196,954 bp
  • A to G, chromosome 4 at 139,669,735 bp
  • A to G, chromosome 4 at 148,666,833 bp
  • A to G, chromosome 5 at 57,721,812 bp
  • G to A, chromosome 5 at 89,677,716 bp
  • G to T, chromosome 5 at 94,683,554 bp
  • G to A, chromosome 5 at 106,455,486 bp
  • A to G, chromosome 5 at 110,865,592 bp
  • A to G, chromosome 5 at 114,801,737 bp
  • T to A, chromosome 5 at 136,104,592 bp
  • A to T, chromosome 5 at 150,066,423 bp
  • T to A, chromosome 6 at 61,810,858 bp
  • T to C, chromosome 6 at 124,962,408 bp
  • A to G, chromosome 7 at 23,321,131 bp
  • A to T, chromosome 7 at 46,072,580 bp
  • T to A, chromosome 7 at 112,381,464 bp
  • A to G, chromosome 7 at 126,471,120 bp
  • A to T, chromosome 7 at 142,009,524 bp
  • A to G, chromosome 8 at 61,550,164 bp
  • G to A, chromosome 8 at 70,334,165 bp
  • T to C, chromosome 8 at 91,800,287 bp
  • A to T, chromosome 8 at 95,263,108 bp
  • C to A, chromosome 8 at 119,612,986 bp
  • G to A, chromosome 9 at 36,892,871 bp
  • A to G, chromosome 9 at 39,046,781 bp
  • A to G, chromosome 9 at 45,147,871 bp
  • G to T, chromosome 9 at 85,743,404 bp
  • G to T, chromosome 9 at 108,107,553 bp
  • T to C, chromosome 10 at 82,286,545 bp
  • C to T, chromosome 10 at 122,878,546 bp
  • T to C, chromosome 10 at 127,180,590 bp
  • A to G, chromosome 11 at 16,911,635 bp
  • A to G, chromosome 11 at 67,205,913 bp
  • A to T, chromosome 11 at 67,891,481 bp
  • A to C, chromosome 11 at 94,742,085 bp
  • G to T, chromosome 11 at 98,970,163 bp
  • C to A, chromosome 12 at 101,520,645 bp
  • A to G, chromosome 13 at 46,773,678 bp
  • T to A, chromosome 13 at 49,728,701 bp
  • T to G, chromosome 14 at 50,424,834 bp
  • T to C, chromosome 14 at 69,175,174 bp
  • T to C, chromosome 14 at 79,092,375 bp
  • A to G, chromosome 14 at 108,911,707 bp
  • T to A, chromosome 15 at 66,532,757 bp
  • C to T, chromosome 15 at 68,084,555 bp
  • T to C, chromosome 15 at 100,703,366 bp
  • T to C, chromosome 15 at 102,111,604 bp
  • T to A, chromosome 15 at 103,309,198 bp
  • CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA to CCGGA, chromosome 16 at 21,653,398 bp
  • A to T, chromosome 16 at 37,208,164 bp
  • G to A, chromosome 16 at 44,503,568 bp
  • A to T, chromosome 16 at 44,957,739 bp
  • G to A, chromosome 17 at 8,341,644 bp
  • T to A, chromosome 17 at 19,066,270 bp
  • T to A, chromosome 17 at 21,287,094 bp
  • T to A, chromosome 17 at 36,548,959 bp
  • C to T, chromosome 17 at 78,837,860 bp
  • C to T, chromosome 18 at 42,688,334 bp
  • G to A, chromosome 18 at 77,248,476 bp
  • A to C, chromosome 19 at 3,716,686 bp
  • T to A, chromosome 19 at 43,890,242 bp
  • T to A, chromosome 19 at 56,842,713 bp
  • T to C, chromosome X at 101,308,784 bp

Strain Description

Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.

Strain Origin

Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8906 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color
Black

Breeding

MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
068699-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.