MMRRC:068710-MU

T to A, chromosome 1 at 6,263,217 bp
G to A, chromosome 1 at 93,940,848 bp
G to A, chromosome 1 at 118,668,717 bp
A to T, chromosome 2 at 13,696,894 bp
A to T, chromosome 2 at 31,314,415 bp
C to T, chromosome 2 at 76,762,263 bp
T to C, chromosome 2 at 84,860,106 bp
T to C, chromosome 2 at 110,731,907 bp
T to C, chromosome 2 at 127,226,982 bp
T to A, chromosome 2 at 130,999,237 bp
A to G, chromosome 3 at 41,082,690 bp
A to T, chromosome 3 at 64,259,252 bp
G to A, chromosome 3 at 88,747,744 bp
C to A, chromosome 3 at 116,968,471 bp
A to G, chromosome 3 at 129,321,358 bp
A to T, chromosome 3 at 129,800,544 bp
A to T, chromosome 3 at 136,284,173 bp
A to T, chromosome 4 at 32,823,452 bp
T to C, chromosome 4 at 133,304,159 bp
T to A, chromosome 4 at 139,463,575 bp
T to C, chromosome 4 at 141,474,063 bp
T to C, chromosome 4 at 143,696,992 bp
C to A, chromosome 4 at 150,614,874 bp
A to T, chromosome 5 at 4,044,048 bp
T to C, chromosome 5 at 137,395,626 bp
C to A, chromosome 5 at 144,820,253 bp
A to T, chromosome 6 at 40,926,065 bp
T to C, chromosome 6 at 56,884,716 bp
G to A, chromosome 6 at 123,316,324 bp
A to T, chromosome 6 at 143,907,443 bp
A to G, chromosome 7 at 30,360,026 bp
T to A, chromosome 7 at 75,534,853 bp
A to G, chromosome 7 at 104,179,742 bp
T to C, chromosome 7 at 105,747,419 bp
A to G, chromosome 7 at 128,454,991 bp
T to G, chromosome 7 at 130,900,511 bp
G to A, chromosome 7 at 133,678,971 bp
T to C, chromosome 8 at 45,030,313 bp
A to G, chromosome 8 at 104,951,037 bp
T to C, chromosome 8 at 109,556,466 bp
T to C, chromosome 9 at 56,146,599 bp
T to C, chromosome 9 at 88,462,847 bp
T to C, chromosome 9 at 103,484,782 bp
C to T, chromosome 9 at 108,294,509 bp
A to G, chromosome 10 at 11,185,437 bp
A to T, chromosome 10 at 26,986,820 bp
T to A, chromosome 10 at 62,664,651 bp
T to C, chromosome 10 at 88,905,023 bp
T to C, chromosome 10 at 105,765,261 bp
T to C, chromosome 10 at 123,059,205 bp
T to A, chromosome 11 at 74,122,048 bp
A to G, chromosome 11 at 76,967,057 bp
A to G, chromosome 11 at 99,348,725 bp
A to T, chromosome 11 at 115,882,301 bp
A to T, chromosome 11 at 119,430,274 bp
G to A, chromosome 11 at 121,160,969 bp
T to G, chromosome 12 at 55,702,560 bp
T to A, chromosome 12 at 78,819,341 bp
T to A, chromosome 12 at 104,797,082 bp
T to C, chromosome 12 at 110,618,037 bp
T to C, chromosome 12 at 111,485,739 bp
A to T, chromosome 13 at 93,096,332 bp
A to T, chromosome 14 at 52,006,767 bp
TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
A to T, chromosome 15 at 55,047,453 bp
A to G, chromosome 15 at 79,126,998 bp
G to A, chromosome 16 at 73,973,261 bp
G to T, chromosome 16 at 73,973,262 bp
G to T, chromosome 16 at 92,499,357 bp
G to A, chromosome 16 at 95,296,689 bp
A to G, chromosome 17 at 24,983,982 bp
C to T, chromosome 19 at 4,871,770 bp
A to G, chromosome 19 at 5,747,484 bp
C to T, chromosome 19 at 7,791,025 bp
G to A, chromosome 19 at 28,665,866 bp
T to C, chromosome 19 at 40,373,562 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R8937 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
068710-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All