Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9229Btlr/Mmmh
Stock Number:
069061-MU
Citation ID:
RRID:MMRRC_069061-MU
Other Names:
R9229 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pvalb
Name: parvalbumin
Synonyms: PV, Pva, Parv
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19293
HGNC: HGNC:9704
Homologene: 2137
Plin3
Name: perilipin 3
Synonyms: 1300012C15Rik, Tip47, M6prbp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66905
VEGA: 17
Homologene: 4247
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to G, chromosome 1 at 52,708,744 bp (GRCm38)
  • A to G, chromosome 1 at 97,825,935 bp (GRCm38)
  • A to T, chromosome 1 at 105,686,984 bp (GRCm38)
  • A to G, chromosome 1 at 129,921,290 bp (GRCm38)
  • A to G, chromosome 1 at 131,668,124 bp (GRCm38)
  • G to T, chromosome 1 at 139,053,362 bp (GRCm38)
  • A to G, chromosome 1 at 152,845,220 bp (GRCm38)
  • A to T, chromosome 1 at 163,967,090 bp (GRCm38)
  • C to T, chromosome 1 at 167,308,563 bp (GRCm38)
  • A to T, chromosome 1 at 174,240,184 bp (GRCm38)
  • G to A, chromosome 2 at 24,983,491 bp (GRCm38)
  • C to A, chromosome 2 at 28,462,378 bp (GRCm38)
  • A to G, chromosome 2 at 74,694,256 bp (GRCm38)
  • A to T, chromosome 2 at 76,767,453 bp (GRCm38)
  • G to A, chromosome 2 at 87,308,821 bp (GRCm38)
  • G to C, chromosome 2 at 127,247,142 bp (GRCm38)
  • T to C, chromosome 2 at 173,276,169 bp (GRCm38)
  • C to A, chromosome 3 at 80,802,382 bp (GRCm38)
  • A to G, chromosome 3 at 96,684,899 bp (GRCm38)
  • T to A, chromosome 3 at 113,532,306 bp (GRCm38)
  • G to A, chromosome 3 at 116,645,469 bp (GRCm38)
  • G to A, chromosome 3 at 135,336,534 bp (GRCm38)
  • A to T, chromosome 4 at 117,901,604 bp (GRCm38)
  • A to T, chromosome 5 at 14,977,704 bp (GRCm38)
  • A to T, chromosome 5 at 93,636,230 bp (GRCm38)
  • G to A, chromosome 5 at 112,378,039 bp (GRCm38)
  • G to T, chromosome 5 at 113,865,686 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 22,986,284 bp (GRCm38)
  • T to A, chromosome 6 at 42,040,116 bp (GRCm38)
  • T to A, chromosome 6 at 42,040,118 bp (GRCm38)
  • A to T, chromosome 6 at 106,800,056 bp (GRCm38)
  • A to G, chromosome 6 at 136,329,143 bp (GRCm38)
  • T to A, chromosome 7 at 5,301,053 bp (GRCm38)
  • C to T, chromosome 7 at 18,856,550 bp (GRCm38)
  • T to A, chromosome 7 at 23,321,374 bp (GRCm38)
  • A to G, chromosome 7 at 42,142,299 bp (GRCm38)
  • G to A, chromosome 7 at 56,724,520 bp (GRCm38)
  • G to A, chromosome 7 at 77,124,522 bp (GRCm38)
  • A to T, chromosome 7 at 83,957,625 bp (GRCm38)
  • C to T, chromosome 7 at 132,981,388 bp (GRCm38)
  • T to A, chromosome 8 at 3,429,314 bp (GRCm38)
  • A to C, chromosome 8 at 11,007,400 bp (GRCm38)
  • A to T, chromosome 8 at 12,397,390 bp (GRCm38)
  • A to G, chromosome 8 at 13,013,584 bp (GRCm38)
  • A to G, chromosome 8 at 22,939,971 bp (GRCm38)
  • A to T, chromosome 8 at 25,038,541 bp (GRCm38)
  • A to G, chromosome 8 at 66,484,127 bp (GRCm38)
  • T to A, chromosome 9 at 104,036,177 bp (GRCm38)
  • A to G, chromosome 10 at 88,758,377 bp (GRCm38)
  • G to T, chromosome 10 at 107,411,983 bp (GRCm38)
  • A to T, chromosome 10 at 116,549,055 bp (GRCm38)
  • T to A, chromosome 11 at 50,833,059 bp (GRCm38)
  • A to T, chromosome 11 at 96,300,819 bp (GRCm38)
  • A to G, chromosome 12 at 70,943,485 bp (GRCm38)
  • T to C, chromosome 12 at 102,234,724 bp (GRCm38)
  • T to C, chromosome 13 at 13,991,522 bp (GRCm38)
  • T to C, chromosome 13 at 23,696,046 bp (GRCm38)
  • G to T, chromosome 13 at 73,505,531 bp (GRCm38)
  • A to G, chromosome 13 at 93,095,668 bp (GRCm38)
  • TA to TAA, chromosome 13 at 102,705,006 bp (GRCm38)
  • A to G, chromosome 14 at 20,716,325 bp (GRCm38)
  • G to A, chromosome 14 at 49,014,253 bp (GRCm38)
  • C to T, chromosome 14 at 56,564,719 bp (GRCm38)
  • T to C, chromosome 14 at 57,613,699 bp (GRCm38)
  • T to A, chromosome 14 at 63,135,663 bp (GRCm38)
  • T to A, chromosome 15 at 10,409,511 bp (GRCm38)
  • T to A, chromosome 15 at 38,490,402 bp (GRCm38)
  • T to A, chromosome 15 at 77,790,817 bp (GRCm38)
  • T to A, chromosome 15 at 78,202,567 bp (GRCm38)
  • C to T, chromosome 15 at 83,854,472 bp (GRCm38)
  • G to T, chromosome 16 at 13,412,321 bp (GRCm38)
  • A to G, chromosome 16 at 89,837,831 bp (GRCm38)
  • A to C, chromosome 17 at 28,532,371 bp (GRCm38)
  • G to T, chromosome 17 at 34,611,689 bp (GRCm38)
  • G to A, chromosome 17 at 40,831,190 bp (GRCm38)
  • A to G, chromosome 17 at 48,366,746 bp (GRCm38)
  • A to T, chromosome 17 at 56,284,315 bp (GRCm38)
  • C to A, chromosome 18 at 7,127,324 bp (GRCm38)
  • C to T, chromosome 18 at 69,947,132 bp (GRCm38)
  • T to A, chromosome 19 at 13,634,050 bp (GRCm38)
  • T to C, chromosome 19 at 37,284,199 bp (GRCm38)
  • T to G, chromosome 19 at 50,152,862 bp (GRCm38)
  • T to C, chromosome 19 at 56,321,907 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9229 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069061-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.