Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9248Btlr/Mmmh
Stock Number:
069073-MU
Citation ID:
RRID:MMRRC_069073-MU
Other Names:
R9248 (G1)
Major Collection:

Strain Information

Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to C, chromosome 1 at 36,210,022 bp (GRCm38)
  • A to G, chromosome 1 at 43,764,924 bp (GRCm38)
  • A to C, chromosome 1 at 75,421,776 bp (GRCm38)
  • A to G, chromosome 1 at 87,153,390 bp (GRCm38)
  • A to G, chromosome 1 at 166,163,827 bp (GRCm38)
  • A to G, chromosome 1 at 182,748,656 bp (GRCm38)
  • A to T, chromosome 2 at 24,848,065 bp (GRCm38)
  • A to G, chromosome 2 at 26,593,589 bp (GRCm38)
  • T to C, chromosome 4 at 18,862,113 bp (GRCm38)
  • A to G, chromosome 4 at 47,474,001 bp (GRCm38)
  • T to C, chromosome 4 at 104,846,002 bp (GRCm38)
  • C to T, chromosome 5 at 113,063,228 bp (GRCm38)
  • G to C, chromosome 5 at 117,879,337 bp (GRCm38)
  • G to T, chromosome 6 at 47,957,503 bp (GRCm38)
  • T to A, chromosome 6 at 83,031,912 bp (GRCm38)
  • T to A, chromosome 6 at 91,254,574 bp (GRCm38)
  • A to T, chromosome 6 at 124,512,621 bp (GRCm38)
  • C to T, chromosome 7 at 27,973,718 bp (GRCm38)
  • T to C, chromosome 7 at 108,104,049 bp (GRCm38)
  • T to C, chromosome 7 at 141,160,801 bp (GRCm38)
  • A to G, chromosome 8 at 22,351,473 bp (GRCm38)
  • A to G, chromosome 8 at 93,333,691 bp (GRCm38)
  • A to G, chromosome 9 at 20,922,112 bp (GRCm38)
  • T to C, chromosome 9 at 31,091,609 bp (GRCm38)
  • T to C, chromosome 9 at 38,219,410 bp (GRCm38)
  • A to G, chromosome 9 at 51,057,460 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to C, chromosome 9 at 119,153,934 bp (GRCm38)
  • C to A, chromosome 10 at 8,741,532 bp (GRCm38)
  • C to T, chromosome 10 at 41,277,482 bp (GRCm38)
  • T to C, chromosome 10 at 42,698,214 bp (GRCm38)
  • T to A, chromosome 10 at 86,731,249 bp (GRCm38)
  • T to A, chromosome 10 at 86,891,617 bp (GRCm38)
  • G to T, chromosome 11 at 75,445,430 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,210 bp (GRCm38)
  • A to G, chromosome 11 at 82,444,482 bp (GRCm38)
  • A to T, chromosome 11 at 83,518,455 bp (GRCm38)
  • A to T, chromosome 11 at 101,460,554 bp (GRCm38)
  • C to T, chromosome 12 at 8,015,231 bp (GRCm38)
  • T to C, chromosome 12 at 51,916,243 bp (GRCm38)
  • A to G, chromosome 12 at 66,689,452 bp (GRCm38)
  • C to T, chromosome 12 at 76,107,456 bp (GRCm38)
  • T to C, chromosome 12 at 80,339,789 bp (GRCm38)
  • C to A, chromosome 13 at 4,242,975 bp (GRCm38)
  • A to G, chromosome 13 at 30,226,409 bp (GRCm38)
  • A to G, chromosome 13 at 58,409,085 bp (GRCm38)
  • A to G, chromosome 13 at 81,711,650 bp (GRCm38)
  • T to A, chromosome 13 at 100,654,352 bp (GRCm38)
  • C to T, chromosome 15 at 74,613,318 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to G, chromosome 16 at 45,550,188 bp (GRCm38)
  • A to T, chromosome 17 at 22,343,638 bp (GRCm38)
  • A to T, chromosome 17 at 56,112,324 bp (GRCm38)
  • G to A, chromosome 17 at 81,026,611 bp (GRCm38)
  • A to T, chromosome 18 at 37,444,555 bp (GRCm38)
  • A to C, chromosome 18 at 43,552,177 bp (GRCm38)
  • T to A, chromosome 19 at 12,429,010 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9248 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069073-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.