Strain Name:
C57BL/6J-MtgxR9269Btlr/Mmmh
Stock Number:
069089-MU
Citation ID:
RRID:MMRRC_069089-MU
Other Names:
R9269 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Zic1
Name: zinc finger protein of the cerebellum 1
Synonyms: odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22771
Homologene: 2562
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Srek1
Name: splicing regulatory glutamine/lysine-rich protein 1
Synonyms: SRrp508, SRrp86, Sfrs12, AL118220
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218543
Homologene: 10581
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Prcc
Name: papillary renal cell carcinoma (translocation-associated)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94315
HGNC: HGNC:9343
Homologene: 38120
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, Hps2, recombination induced mutation 2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Spast
Name: spastin
Synonyms: Spg4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50850
VEGA: 17
Homologene: 8970
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Rnpc3
Name: RNA-binding region (RNP1, RRM) containing 3
Synonyms: C030014B17Rik, 2810441O16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67225
Homologene: 9746
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Klf10
Name: Kruppel-like transcription factor 10
Synonyms: mGIF, Gdnfif, Egral, Tieg1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21847
VEGA: 15
Homologene: 4135
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Phox2b
Name: paired-like homeobox 2b
Synonyms: Phox2b, NBPhox, Pmx2b, GENA 269, Dilp1, Px2b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18935
HGNC: HGNC:9143
Homologene: 68371
Doc2a
Name: double C2, alpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13446
HGNC: HGNC:2985
Homologene: 2657
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Tes
Name: testin LIM domain protein
Synonyms: Tes2, Tes1, testin2, testin, D6Ertd352e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21753
Homologene: 41051
Gtpbp1
Name: GTP binding protein 1
Synonyms: GP-1, GTPBP1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14904
VEGA: 15
HGNC: HGNC:4669
Homologene: 3165
Pi4kb
Name: phosphatidylinositol 4-kinase beta
Synonyms: ESTM41, Pik4cb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107650
HGNC: HGNC:8984
Homologene: 6741
Sugp1
Name: SURP and G patch domain containing 1
Synonyms: Sf4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70616
Homologene: 12360
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Zfp386
Name: zinc finger protein 386 (Kruppel-like)
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56220
Homologene: 51668
Clvs2
Name: clavesin 2
Synonyms: A330019N05Rik, Rlbp1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215890
Homologene: 27894
Anapc4
Name: anaphase promoting complex subunit 4
Synonyms: 2610306D21Rik, APC4, D5Ertd249e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52206
Homologene: 40873
Btbd16
Name: BTB domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330660
Homologene: 77327
Wdr89
Name: WD repeat domain 89
Synonyms: 2600001A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72338
Homologene: 43791
Arrdc2
Name: arrestin domain containing 2
Synonyms: 4632416I05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70807
Homologene: 79540
Galnt2
Name: polypeptide N-acetylgalactosaminyltransferase 2
Synonyms: ppGaNTase-T2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108148
HGNC: HGNC:4124
Homologene: 3297
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56631
Homologene: 9387
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Lamc3
Name: laminin gamma 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23928
HGNC: HGNC:6494
Homologene: 21222
Gcnt3
Name: glucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms: 2010013H22Rik, 2210021I22Rik, 2210401J11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72077
VEGA: 9
HGNC: HGNC:4205
Homologene: 20993
Borcs8
Name: BLOC-1 related complex subunit 8
Synonyms: 2310045N01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72368
Homologene: 47492
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Dock3
Name: dedicator of cyto-kinesis 3
Synonyms: PBP, Moca
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208869
HGNC: HGNC:2989
Homologene: 21030
Slc4a5
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms: C330016K18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232156
Homologene: 31125
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: arachidonate 5 lipoxygenase activating protein, Flap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Or7e175
Name: olfactory receptor family 7 subfamily E member 175
Synonyms: GA_x6K02T2PVTD-13878275-13879204, MOR145-6, Olfr869
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258550
HGNC: HGNC:8396
Homologene: 138312
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P, Olfr1281
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Slc22a5
Name: solute carrier family 22 (organic cation transporter), member 5
Synonyms: Octn2, Lstpl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20520
Homologene: 68295
Vmn1r170
Name: vomeronasal 1 receptor 170
Synonyms: Gm5999
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546944
Homologene: 128341
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Or5p52
Name: olfactory receptor family 5 subfamily P member 52
Synonyms: GA_x6K02T2PBJ9-10231953-10232885, MOR204-5, Olfr472
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258770
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212892
Homologene: 71779
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: GA_x6K02T2RE5P-3357666-3356743, MOR202-6, Olfr1453
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Hid1
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217310
Homologene: 12737
Or4p18
Name: olfactory receptor family 4 subfamily P member 18
Synonyms: GA_x6K02T2Q125-49890854-49889931, MOR225-2, Olfr1179
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258919
Homologene: 74070
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Atxn1
Name: ataxin 1
Synonyms: Atx1, Sca1, 2900016G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
Rchy1
Name: ring finger and CHY zinc finger domain containing 1
Synonyms: PRO1996, 6720407C15Rik, Zfp363, Pirh2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68098
Homologene: 22894
Ranbp6
Name: RAN binding protein 6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240614
HGNC: HGNC:9851
Homologene: 18935
Arhgef26
Name: Rho guanine nucleotide exchange factor 26
Synonyms: 8430436L14Rik, 4631416L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 622434
Homologene: 9204
Or8k1
Name: olfactory receptor family 8 subfamily K member 1
Synonyms: GA_x6K02T2Q125-47692494-47691544, MOR194-1, Olfr1046
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258575
Homologene: 17301
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Lmx1a
Name: LIM homeobox transcription factor 1 alpha
Synonyms: Lmx1.1, shaker short-tail
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110648
HGNC: HGNC:6653
Homologene: 24921
Fcgr1
Name: Fc receptor, IgG, high affinity I
Synonyms: CD64, FcgammaRI
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14129
Homologene: 475
Begain
Name: brain-enriched guanylate kinase-associated
Synonyms: LOC380785
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380785
Homologene: 10829
S100a13
Name: S100 calcium binding protein A13
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20196
Homologene: 7523
Or4a68
Name: olfactory receptor family 4 subfamily A member 68
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8, Olfr1240
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258804
Homologene: 121591
Pak1ip1
Name: PAK1 interacting protein 1
Synonyms: 5830431I15Rik, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1, Gdpd1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68083
Homologene: 39574
Or2d2
Name: olfactory receptor family 2 subfamily D member 2
Synonyms: GA_x6K02T2PBJ9-9479517-9478573, MOR260-1, Olfr715
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258776
HGNC: HGNC:8244
Homologene: 81541
Vat1l
Name: vesicle amine transport protein 1 like
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270097
Homologene: 10855
Nkx2-4
Name: NK2 homeobox 4
Synonyms: Nkx-2.4, tinman, 1700001P03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228731
HGNC: HGNC:7837
Homologene: 41526
Orai3
Name: ORAI calcium release-activated calcium modulator 3
Synonyms: Tmem142c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269999
Homologene: 72082
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Fndc10
Name: fibronectin type III domain containing 10
Synonyms: B930041F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230991
Homologene: 130478
Rmi1
Name: RecQ mediated genome instability 1
Synonyms: 4932432N11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74386
VEGA: 13
Homologene: 41601
Pcp4l1
Name: Purkinje cell protein 4-like 1
Synonyms: 1500036F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66425
Homologene: 136091
Rwdd1
Name: RWD domain containing 1
Synonyms: 2700069A07Rik, 2610002D06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66521
Homologene: 41082
Or5b114-ps1
Name: olfactory receptor family 5 subfamily B member 114, pseudogene 1
Synonyms: GA_x6K02T2RE5P-3706029-3706953, MOR202-21, Olfr1468-ps1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258192
Ighv5-8
Name: immunoglobulin heavy variable V5-8
Synonyms: Gm17309
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 777782
Cldn3
Name: claudin 3
Synonyms: Cpetr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12739
HGNC: HGNC:2045
Homologene: 1001
Eif4a3l2
Name: eukaryotic translation initiation factor 4A3 like 2
Synonyms: Gm5580
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434080
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 9,872,309 bp (GRCm38)
  • C to T, chromosome 1 at 159,288,983 bp (GRCm38)
  • T to A, chromosome 1 at 167,830,625 bp (GRCm38)
  • T to C, chromosome 1 at 171,174,406 bp (GRCm38)
  • T to C, chromosome 2 at 31,923,005 bp (GRCm38)
  • C to A, chromosome 2 at 31,928,896 bp (GRCm38)
  • A to G, chromosome 2 at 59,800,088 bp (GRCm38)
  • T to C, chromosome 2 at 86,216,903 bp (GRCm38)
  • G to A, chromosome 2 at 88,402,242 bp (GRCm38)
  • T to A, chromosome 2 at 89,439,932 bp (GRCm38)
  • T to C, chromosome 2 at 111,328,952 bp (GRCm38)
  • T to C, chromosome 2 at 147,084,264 bp (GRCm38)
  • T to A, chromosome 2 at 150,409,367 bp (GRCm38)
  • G to C, chromosome 2 at 153,804,941 bp (GRCm38)
  • A to G, chromosome 3 at 62,340,499 bp (GRCm38)
  • A to T, chromosome 3 at 87,869,731 bp (GRCm38)
  • G to T, chromosome 3 at 90,515,863 bp (GRCm38)
  • A to G, chromosome 3 at 94,984,486 bp (GRCm38)
  • C to T, chromosome 3 at 96,285,838 bp (GRCm38)
  • A to C, chromosome 3 at 113,611,246 bp (GRCm38)
  • T to C, chromosome 3 at 123,117,324 bp (GRCm38)
  • T to C, chromosome 4 at 43,171,955 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • T to C, chromosome 4 at 155,694,748 bp (GRCm38)
  • T to A, chromosome 5 at 52,861,278 bp (GRCm38)
  • T to C, chromosome 5 at 53,154,286 bp (GRCm38)
  • T to A, chromosome 5 at 67,098,721 bp (GRCm38)
  • G to T, chromosome 5 at 91,957,972 bp (GRCm38)
  • T to C, chromosome 5 at 134,986,725 bp (GRCm38)
  • A to T, chromosome 5 at 140,906,761 bp (GRCm38)
  • A to G, chromosome 5 at 149,279,196 bp (GRCm38)
  • T to A, chromosome 6 at 17,100,342 bp (GRCm38)
  • T to C, chromosome 6 at 32,178,380 bp (GRCm38)
  • T to C, chromosome 6 at 83,289,241 bp (GRCm38)
  • T to C, chromosome 6 at 89,329,559 bp (GRCm38)
  • C to T, chromosome 6 at 116,552,356 bp (GRCm38)
  • T to C, chromosome 6 at 121,660,906 bp (GRCm38)
  • T to A, chromosome 7 at 23,606,838 bp (GRCm38)
  • T to C, chromosome 7 at 55,795,945 bp (GRCm38)
  • C to A, chromosome 7 at 55,907,431 bp (GRCm38)
  • T to C, chromosome 7 at 85,751,203 bp (GRCm38)
  • T to C, chromosome 7 at 107,128,626 bp (GRCm38)
  • T to A, chromosome 7 at 107,903,320 bp (GRCm38)
  • T to C, chromosome 7 at 126,469,182 bp (GRCm38)
  • T to A, chromosome 7 at 126,850,987 bp (GRCm38)
  • G to T, chromosome 7 at 127,774,022 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • G to T, chromosome 8 at 70,056,570 bp (GRCm38)
  • C to A, chromosome 8 at 70,141,871 bp (GRCm38)
  • G to A, chromosome 8 at 70,836,329 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to C, chromosome 8 at 110,812,026 bp (GRCm38)
  • C to T, chromosome 8 at 114,289,432 bp (GRCm38)
  • T to A, chromosome 8 at 124,338,463 bp (GRCm38)
  • T to C, chromosome 9 at 20,137,461 bp (GRCm38)
  • T to C, chromosome 9 at 70,034,008 bp (GRCm38)
  • T to C, chromosome 9 at 91,364,320 bp (GRCm38)
  • T to C, chromosome 9 at 106,941,323 bp (GRCm38)
  • T to C, chromosome 10 at 28,863,394 bp (GRCm38)
  • A to T, chromosome 10 at 33,543,426 bp (GRCm38)
  • T to A, chromosome 10 at 33,909,398 bp (GRCm38)
  • T to C, chromosome 10 at 34,012,099 bp (GRCm38)
  • C to T, chromosome 11 at 53,876,155 bp (GRCm38)
  • T to C, chromosome 11 at 58,971,431 bp (GRCm38)
  • T to C, chromosome 11 at 115,361,676 bp (GRCm38)
  • T to A, chromosome 12 at 75,632,790 bp (GRCm38)
  • A to T, chromosome 12 at 79,276,302 bp (GRCm38)
  • T to A, chromosome 12 at 80,172,971 bp (GRCm38)
  • A to G, chromosome 12 at 105,652,100 bp (GRCm38)
  • T to A, chromosome 12 at 109,033,193 bp (GRCm38)
  • TATATATATATATATATATATA to TATATATATATATATATATATATA, chromosome 12 at 113,654,945 bp (GRCm38)
  • A to T, chromosome 12 at 115,920,541 bp (GRCm38)
  • A to G, chromosome 12 at 116,059,663 bp (GRCm38)
  • G to A, chromosome 13 at 41,009,251 bp (GRCm38)
  • T to A, chromosome 13 at 45,557,204 bp (GRCm38)
  • C to T, chromosome 13 at 58,409,026 bp (GRCm38)
  • C to A, chromosome 13 at 94,404,062 bp (GRCm38)
  • C to A, chromosome 13 at 95,436,516 bp (GRCm38)
  • T to C, chromosome 13 at 103,753,146 bp (GRCm38)
  • T to A, chromosome 14 at 24,192,813 bp (GRCm38)
  • C to T, chromosome 14 at 50,844,309 bp (GRCm38)
  • A to C, chromosome 15 at 8,219,016 bp (GRCm38)
  • A to G, chromosome 15 at 38,297,758 bp (GRCm38)
  • C to T, chromosome 15 at 79,717,654 bp (GRCm38)
  • A to T, chromosome 17 at 22,601,232 bp (GRCm38)
  • A to C, chromosome 17 at 27,786,075 bp (GRCm38)
  • C to A, chromosome 17 at 74,339,074 bp (GRCm38)
  • A to G, chromosome 18 at 42,327,507 bp (GRCm38)
  • T to C, chromosome 19 at 13,027,630 bp (GRCm38)
  • A to T, chromosome 19 at 13,375,640 bp (GRCm38)
  • A to G, chromosome 19 at 29,809,988 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9269 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069089-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.