Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9269Btlr/Mmmh
Stock Number:
069089-MU
Citation ID:
RRID:MMRRC_069089-MU
Other Names:
R9269 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Zic1
Name: zinc finger protein of the cerebellum 1
Synonyms: odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22771
Homologene: 2562
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 9,872,309 bp (GRCm38)
  • C to T, chromosome 1 at 159,288,983 bp (GRCm38)
  • T to A, chromosome 1 at 167,830,625 bp (GRCm38)
  • T to C, chromosome 1 at 171,174,406 bp (GRCm38)
  • T to C, chromosome 2 at 31,923,005 bp (GRCm38)
  • C to A, chromosome 2 at 31,928,896 bp (GRCm38)
  • A to G, chromosome 2 at 59,800,088 bp (GRCm38)
  • T to C, chromosome 2 at 86,216,903 bp (GRCm38)
  • G to A, chromosome 2 at 88,402,242 bp (GRCm38)
  • T to A, chromosome 2 at 89,439,932 bp (GRCm38)
  • T to C, chromosome 2 at 111,328,952 bp (GRCm38)
  • T to C, chromosome 2 at 147,084,264 bp (GRCm38)
  • T to A, chromosome 2 at 150,409,367 bp (GRCm38)
  • G to C, chromosome 2 at 153,804,941 bp (GRCm38)
  • A to G, chromosome 3 at 62,340,499 bp (GRCm38)
  • A to T, chromosome 3 at 87,869,731 bp (GRCm38)
  • G to T, chromosome 3 at 90,515,863 bp (GRCm38)
  • A to G, chromosome 3 at 94,984,486 bp (GRCm38)
  • C to T, chromosome 3 at 96,285,838 bp (GRCm38)
  • A to C, chromosome 3 at 113,611,246 bp (GRCm38)
  • T to C, chromosome 3 at 123,117,324 bp (GRCm38)
  • T to C, chromosome 4 at 43,171,955 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • T to C, chromosome 4 at 155,694,748 bp (GRCm38)
  • T to A, chromosome 5 at 52,861,278 bp (GRCm38)
  • T to C, chromosome 5 at 53,154,286 bp (GRCm38)
  • T to A, chromosome 5 at 67,098,721 bp (GRCm38)
  • G to T, chromosome 5 at 91,957,972 bp (GRCm38)
  • T to C, chromosome 5 at 134,986,725 bp (GRCm38)
  • A to T, chromosome 5 at 140,906,761 bp (GRCm38)
  • A to G, chromosome 5 at 149,279,196 bp (GRCm38)
  • T to A, chromosome 6 at 17,100,342 bp (GRCm38)
  • T to C, chromosome 6 at 32,178,380 bp (GRCm38)
  • T to C, chromosome 6 at 83,289,241 bp (GRCm38)
  • T to C, chromosome 6 at 89,329,559 bp (GRCm38)
  • C to T, chromosome 6 at 116,552,356 bp (GRCm38)
  • T to C, chromosome 6 at 121,660,906 bp (GRCm38)
  • T to A, chromosome 7 at 23,606,838 bp (GRCm38)
  • T to C, chromosome 7 at 55,795,945 bp (GRCm38)
  • C to A, chromosome 7 at 55,907,431 bp (GRCm38)
  • T to C, chromosome 7 at 85,751,203 bp (GRCm38)
  • T to C, chromosome 7 at 107,128,626 bp (GRCm38)
  • T to A, chromosome 7 at 107,903,320 bp (GRCm38)
  • T to C, chromosome 7 at 126,469,182 bp (GRCm38)
  • T to A, chromosome 7 at 126,850,987 bp (GRCm38)
  • G to T, chromosome 7 at 127,774,022 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • G to T, chromosome 8 at 70,056,570 bp (GRCm38)
  • C to A, chromosome 8 at 70,141,871 bp (GRCm38)
  • G to A, chromosome 8 at 70,836,329 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to C, chromosome 8 at 110,812,026 bp (GRCm38)
  • C to T, chromosome 8 at 114,289,432 bp (GRCm38)
  • T to A, chromosome 8 at 124,338,463 bp (GRCm38)
  • T to C, chromosome 9 at 20,137,461 bp (GRCm38)
  • T to C, chromosome 9 at 70,034,008 bp (GRCm38)
  • T to C, chromosome 9 at 91,364,320 bp (GRCm38)
  • T to C, chromosome 9 at 106,941,323 bp (GRCm38)
  • T to C, chromosome 10 at 28,863,394 bp (GRCm38)
  • A to T, chromosome 10 at 33,543,426 bp (GRCm38)
  • T to A, chromosome 10 at 33,909,398 bp (GRCm38)
  • T to C, chromosome 10 at 34,012,099 bp (GRCm38)
  • C to T, chromosome 11 at 53,876,155 bp (GRCm38)
  • T to C, chromosome 11 at 58,971,431 bp (GRCm38)
  • T to C, chromosome 11 at 115,361,676 bp (GRCm38)
  • T to A, chromosome 12 at 75,632,790 bp (GRCm38)
  • A to T, chromosome 12 at 79,276,302 bp (GRCm38)
  • T to A, chromosome 12 at 80,172,971 bp (GRCm38)
  • A to G, chromosome 12 at 105,652,100 bp (GRCm38)
  • T to A, chromosome 12 at 109,033,193 bp (GRCm38)
  • TATATATATATATATATATATA to TATATATATATATATATATATATA, chromosome 12 at 113,654,945 bp (GRCm38)
  • A to T, chromosome 12 at 115,920,541 bp (GRCm38)
  • A to G, chromosome 12 at 116,059,663 bp (GRCm38)
  • G to A, chromosome 13 at 41,009,251 bp (GRCm38)
  • T to A, chromosome 13 at 45,557,204 bp (GRCm38)
  • C to T, chromosome 13 at 58,409,026 bp (GRCm38)
  • C to A, chromosome 13 at 94,404,062 bp (GRCm38)
  • C to A, chromosome 13 at 95,436,516 bp (GRCm38)
  • T to C, chromosome 13 at 103,753,146 bp (GRCm38)
  • T to A, chromosome 14 at 24,192,813 bp (GRCm38)
  • C to T, chromosome 14 at 50,844,309 bp (GRCm38)
  • A to C, chromosome 15 at 8,219,016 bp (GRCm38)
  • A to G, chromosome 15 at 38,297,758 bp (GRCm38)
  • C to T, chromosome 15 at 79,717,654 bp (GRCm38)
  • A to T, chromosome 17 at 22,601,232 bp (GRCm38)
  • A to C, chromosome 17 at 27,786,075 bp (GRCm38)
  • C to A, chromosome 17 at 74,339,074 bp (GRCm38)
  • A to G, chromosome 18 at 42,327,507 bp (GRCm38)
  • T to C, chromosome 19 at 13,027,630 bp (GRCm38)
  • A to T, chromosome 19 at 13,375,640 bp (GRCm38)
  • A to G, chromosome 19 at 29,809,988 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9269 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069089-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.