Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9492Btlr/Mmmh
Stock Number:
069295-MU
Citation ID:
RRID:MMRRC_069295-MU
Other Names:
R9492 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Gdnf
Name: glial cell line derived neurotrophic factor
Synonyms: glial cell line-derived neurotrophic factor
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14573
VEGA: 15
HGNC: HGNC:4232
Homologene: 433
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 71,258,221 bp (GRCm38)
  • A to C, chromosome 1 at 120,150,742 bp (GRCm38)
  • T to C, chromosome 1 at 123,353,430 bp (GRCm38)
  • A to G, chromosome 2 at 87,371,616 bp (GRCm38)
  • G to T, chromosome 3 at 25,434,316 bp (GRCm38)
  • A to G, chromosome 3 at 58,541,054 bp (GRCm38)
  • A to G, chromosome 3 at 75,333,362 bp (GRCm38)
  • C to A, chromosome 3 at 88,108,869 bp (GRCm38)
  • A to G, chromosome 3 at 90,487,263 bp (GRCm38)
  • G to C, chromosome 3 at 114,212,103 bp (GRCm38)
  • A to G, chromosome 3 at 116,594,632 bp (GRCm38)
  • A to G, chromosome 4 at 14,818,349 bp (GRCm38)
  • A to G, chromosome 4 at 34,810,794 bp (GRCm38)
  • T to C, chromosome 4 at 83,001,820 bp (GRCm38)
  • A to G, chromosome 4 at 124,658,386 bp (GRCm38)
  • A to T, chromosome 4 at 141,471,787 bp (GRCm38)
  • T to A, chromosome 4 at 148,484,344 bp (GRCm38)
  • T to C, chromosome 4 at 152,008,962 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • T to A, chromosome 5 at 24,439,763 bp (GRCm38)
  • A to G, chromosome 5 at 36,029,140 bp (GRCm38)
  • A to G, chromosome 5 at 92,167,332 bp (GRCm38)
  • A to G, chromosome 5 at 151,642,946 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 23,427,239 bp (GRCm38)
  • G to T, chromosome 6 at 48,568,827 bp (GRCm38)
  • T to C, chromosome 6 at 48,978,606 bp (GRCm38)
  • A to G, chromosome 6 at 125,061,099 bp (GRCm38)
  • A to G, chromosome 7 at 3,164,193 bp (GRCm38)
  • G to T, chromosome 7 at 17,975,543 bp (GRCm38)
  • A to G, chromosome 7 at 66,047,598 bp (GRCm38)
  • G to A, chromosome 7 at 87,472,496 bp (GRCm38)
  • C to G, chromosome 7 at 87,472,497 bp (GRCm38)
  • C to T, chromosome 7 at 102,129,045 bp (GRCm38)
  • G to T, chromosome 7 at 104,429,123 bp (GRCm38)
  • G to T, chromosome 7 at 127,023,120 bp (GRCm38)
  • G to A, chromosome 7 at 127,889,630 bp (GRCm38)
  • C to T, chromosome 8 at 12,844,490 bp (GRCm38)
  • A to T, chromosome 8 at 40,753,699 bp (GRCm38)
  • A to G, chromosome 8 at 71,482,140 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • A to G, chromosome 8 at 110,600,245 bp (GRCm38)
  • A to G, chromosome 8 at 126,321,287 bp (GRCm38)
  • T to A, chromosome 9 at 21,194,800 bp (GRCm38)
  • C to T, chromosome 9 at 37,304,369 bp (GRCm38)
  • T to C, chromosome 9 at 48,468,876 bp (GRCm38)
  • A to G, chromosome 10 at 21,998,197 bp (GRCm38)
  • T to A, chromosome 10 at 45,671,134 bp (GRCm38)
  • A to G, chromosome 10 at 107,642,952 bp (GRCm38)
  • T to A, chromosome 11 at 9,293,667 bp (GRCm38)
  • T to C, chromosome 11 at 58,831,784 bp (GRCm38)
  • G to A, chromosome 11 at 62,552,158 bp (GRCm38)
  • A to G, chromosome 11 at 73,296,441 bp (GRCm38)
  • C to T, chromosome 11 at 76,508,925 bp (GRCm38)
  • T to A, chromosome 11 at 94,483,618 bp (GRCm38)
  • T to A, chromosome 11 at 100,801,535 bp (GRCm38)
  • T to C, chromosome 11 at 101,763,982 bp (GRCm38)
  • T to A, chromosome 12 at 75,949,065 bp (GRCm38)
  • T to C, chromosome 12 at 83,992,610 bp (GRCm38)
  • T to C, chromosome 12 at 105,658,290 bp (GRCm38)
  • C to T, chromosome 13 at 34,959,993 bp (GRCm38)
  • T to C, chromosome 13 at 55,002,475 bp (GRCm38)
  • T to C, chromosome 13 at 93,041,314 bp (GRCm38)
  • A to G, chromosome 14 at 54,172,394 bp (GRCm38)
  • C to T, chromosome 15 at 7,810,942 bp (GRCm38)
  • T to C, chromosome 16 at 46,395,148 bp (GRCm38)
  • C to T, chromosome 17 at 20,776,600 bp (GRCm38)
  • T to A, chromosome 17 at 34,198,461 bp (GRCm38)
  • A to T, chromosome 17 at 86,996,945 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9492 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069295-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.