Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9495Btlr/Mmmh
Stock Number:
069298-MU
Citation ID:
RRID:MMRRC_069298-MU
Other Names:
R9495 (G1)
Major Collection:

Strain Information

Figla
Name: folliculogenesis specific basic helix-loop-helix
Synonyms: FIG alpha, bHLHc8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26910
Homologene: 49294
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Plin3
Name: perilipin 3
Synonyms: 1300012C15Rik, Tip47, M6prbp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66905
VEGA: 17
Homologene: 4247
Mix23
Name: mitochondrial matrix import factor 23
Synonyms: A930007B11Rik, Ccdc58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381045
VEGA: 16
Homologene: 18028
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 120,031,673 bp (GRCm38)
  • T to C, chromosome 1 at 150,333,168 bp (GRCm38)
  • T to A, chromosome 1 at 156,030,431 bp (GRCm38)
  • A to G, chromosome 1 at 165,138,977 bp (GRCm38)
  • C to A, chromosome 2 at 119,951,195 bp (GRCm38)
  • A to T, chromosome 2 at 125,319,064 bp (GRCm38)
  • T to C, chromosome 2 at 128,818,433 bp (GRCm38)
  • C to A, chromosome 2 at 131,856,055 bp (GRCm38)
  • G to T, chromosome 2 at 156,097,818 bp (GRCm38)
  • T to C, chromosome 3 at 59,932,693 bp (GRCm38)
  • A to G, chromosome 3 at 96,220,085 bp (GRCm38)
  • T to C, chromosome 3 at 103,331,758 bp (GRCm38)
  • C to T, chromosome 4 at 108,018,909 bp (GRCm38)
  • T to A, chromosome 4 at 116,075,609 bp (GRCm38)
  • T to A, chromosome 4 at 136,264,574 bp (GRCm38)
  • A to T, chromosome 5 at 5,736,458 bp (GRCm38)
  • A to G, chromosome 5 at 33,657,778 bp (GRCm38)
  • A to T, chromosome 5 at 123,700,570 bp (GRCm38)
  • G to A, chromosome 5 at 137,574,439 bp (GRCm38)
  • T to TCCC, chromosome 6 at 4,756,451 bp (GRCm38)
  • T to C, chromosome 6 at 83,032,991 bp (GRCm38)
  • A to C, chromosome 6 at 86,020,707 bp (GRCm38)
  • T to C, chromosome 6 at 113,472,780 bp (GRCm38)
  • A to G, chromosome 6 at 123,712,713 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to T, chromosome 7 at 20,026,537 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to T, chromosome 7 at 43,532,726 bp (GRCm38)
  • GGGACC to GGGACCGGCTCAGCCACGTGGACC, chromosome 7 at 126,467,572 bp (GRCm38)
  • T to A, chromosome 7 at 141,651,133 bp (GRCm38)
  • T to C, chromosome 8 at 25,983,316 bp (GRCm38)
  • C to T, chromosome 8 at 45,956,421 bp (GRCm38)
  • T to C, chromosome 8 at 79,673,458 bp (GRCm38)
  • C to T, chromosome 8 at 83,684,170 bp (GRCm38)
  • G to A, chromosome 9 at 22,127,187 bp (GRCm38)
  • G to C, chromosome 9 at 46,270,646 bp (GRCm38)
  • G to A, chromosome 9 at 58,151,892 bp (GRCm38)
  • C to T, chromosome 9 at 108,480,807 bp (GRCm38)
  • C to A, chromosome 10 at 7,456,371 bp (GRCm38)
  • A to G, chromosome 10 at 7,799,591 bp (GRCm38)
  • A to G, chromosome 10 at 14,655,839 bp (GRCm38)
  • T to A, chromosome 10 at 98,999,798 bp (GRCm38)
  • A to G, chromosome 11 at 69,022,767 bp (GRCm38)
  • T to C, chromosome 11 at 69,454,382 bp (GRCm38)
  • A to G, chromosome 11 at 76,210,923 bp (GRCm38)
  • C to T, chromosome 11 at 87,893,256 bp (GRCm38)
  • T to C, chromosome 11 at 99,609,820 bp (GRCm38)
  • T to C, chromosome 12 at 84,307,873 bp (GRCm38)
  • G to A, chromosome 12 at 86,691,889 bp (GRCm38)
  • A to T, chromosome 13 at 34,050,329 bp (GRCm38)
  • T to A, chromosome 13 at 50,701,429 bp (GRCm38)
  • T to C, chromosome 14 at 54,282,680 bp (GRCm38)
  • A to G, chromosome 15 at 54,462,365 bp (GRCm38)
  • C to T, chromosome 15 at 78,993,178 bp (GRCm38)
  • T to A, chromosome 15 at 79,135,642 bp (GRCm38)
  • G to T, chromosome 15 at 86,033,085 bp (GRCm38)
  • A to G, chromosome 15 at 99,946,885 bp (GRCm38)
  • G to A, chromosome 15 at 101,931,853 bp (GRCm38)
  • A to G, chromosome 16 at 36,072,121 bp (GRCm38)
  • A to T, chromosome 16 at 36,957,340 bp (GRCm38)
  • A to G, chromosome 17 at 27,893,440 bp (GRCm38)
  • G to T, chromosome 17 at 37,280,495 bp (GRCm38)
  • T to A, chromosome 17 at 46,576,818 bp (GRCm38)
  • C to A, chromosome 17 at 56,280,824 bp (GRCm38)
  • G to T, chromosome 18 at 37,022,473 bp (GRCm38)
  • G to T, chromosome 18 at 67,562,612 bp (GRCm38)
  • T to C, chromosome 19 at 3,383,795 bp (GRCm38)
  • T to A, chromosome 19 at 21,801,885 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9495 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069298-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.