Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9515Btlr/Mmmh
Stock Number:
069317-MU
Citation ID:
RRID:MMRRC_069317-MU
Other Names:
R9515 (G1)
Major Collection:

Strain Information

Gpd2
Name: glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms: Gdm1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14571
HGNC: HGNC:4456
Homologene: 352
Bcap29
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12033
VEGA: 12
Homologene: 22411
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Tfr2
Name: transferrin receptor 2
Synonyms: Tfr2, Trfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 20,567,517 bp (GRCm38)
  • T to C, chromosome 1 at 75,556,968 bp (GRCm38)
  • G to A, chromosome 1 at 135,840,902 bp (GRCm38)
  • A to G, chromosome 1 at 171,408,434 bp (GRCm38)
  • T to C, chromosome 1 at 172,318,958 bp (GRCm38)
  • T to G, chromosome 1 at 178,256,604 bp (GRCm38)
  • T to A, chromosome 2 at 27,459,803 bp (GRCm38)
  • A to T, chromosome 2 at 57,305,854 bp (GRCm38)
  • A to T, chromosome 2 at 85,863,578 bp (GRCm38)
  • A to G, chromosome 2 at 111,960,239 bp (GRCm38)
  • C to G, chromosome 2 at 120,704,083 bp (GRCm38)
  • T to G, chromosome 2 at 120,873,146 bp (GRCm38)
  • C to T, chromosome 2 at 122,124,893 bp (GRCm38)
  • C to A, chromosome 2 at 125,365,631 bp (GRCm38)
  • G to T, chromosome 2 at 126,616,229 bp (GRCm38)
  • G to A, chromosome 3 at 142,304,350 bp (GRCm38)
  • A to T, chromosome 3 at 144,803,047 bp (GRCm38)
  • T to C, chromosome 3 at 158,161,468 bp (GRCm38)
  • T to A, chromosome 4 at 58,084,144 bp (GRCm38)
  • T to A, chromosome 4 at 59,879,241 bp (GRCm38)
  • T to A, chromosome 4 at 88,627,982 bp (GRCm38)
  • T to C, chromosome 4 at 112,858,178 bp (GRCm38)
  • C to A, chromosome 4 at 117,267,925 bp (GRCm38)
  • T to A, chromosome 4 at 124,881,911 bp (GRCm38)
  • A to G, chromosome 4 at 133,258,980 bp (GRCm38)
  • G to T, chromosome 4 at 136,336,304 bp (GRCm38)
  • T to A, chromosome 4 at 152,114,369 bp (GRCm38)
  • A to G, chromosome 4 at 154,280,975 bp (GRCm38)
  • C to T, chromosome 5 at 4,055,709 bp (GRCm38)
  • T to C, chromosome 5 at 21,920,510 bp (GRCm38)
  • T to A, chromosome 5 at 34,458,027 bp (GRCm38)
  • A to T, chromosome 5 at 73,672,497 bp (GRCm38)
  • G to A, chromosome 5 at 94,317,065 bp (GRCm38)
  • T to G, chromosome 5 at 136,131,559 bp (GRCm38)
  • A to G, chromosome 5 at 137,577,507 bp (GRCm38)
  • G to C, chromosome 5 at 137,785,497 bp (GRCm38)
  • T to C, chromosome 5 at 150,055,979 bp (GRCm38)
  • GC to GCTCC, chromosome 6 at 4,756,452 bp (GRCm38)
  • T to A, chromosome 6 at 24,734,930 bp (GRCm38)
  • T to A, chromosome 6 at 121,024,797 bp (GRCm38)
  • T to C, chromosome 6 at 121,884,676 bp (GRCm38)
  • T to A, chromosome 6 at 124,061,178 bp (GRCm38)
  • T to C, chromosome 7 at 4,528,101 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to C, chromosome 7 at 75,704,527 bp (GRCm38)
  • A to G, chromosome 7 at 97,575,601 bp (GRCm38)
  • A to T, chromosome 7 at 99,347,277 bp (GRCm38)
  • T to A, chromosome 7 at 122,012,225 bp (GRCm38)
  • A to C, chromosome 7 at 130,764,311 bp (GRCm38)
  • T to A, chromosome 7 at 133,907,644 bp (GRCm38)
  • T to C, chromosome 8 at 13,885,081 bp (GRCm38)
  • T to A, chromosome 8 at 56,125,264 bp (GRCm38)
  • T to C, chromosome 8 at 70,027,503 bp (GRCm38)
  • T to A, chromosome 8 at 85,013,518 bp (GRCm38)
  • T to A, chromosome 8 at 88,311,018 bp (GRCm38)
  • T to A, chromosome 8 at 94,357,030 bp (GRCm38)
  • T to C, chromosome 8 at 109,669,217 bp (GRCm38)
  • T to C, chromosome 9 at 19,567,100 bp (GRCm38)
  • A to G, chromosome 9 at 19,846,520 bp (GRCm38)
  • T to C, chromosome 9 at 39,238,329 bp (GRCm38)
  • C to A, chromosome 9 at 103,480,052 bp (GRCm38)
  • T to A, chromosome 10 at 27,001,174 bp (GRCm38)
  • C to A, chromosome 10 at 80,496,053 bp (GRCm38)
  • T to A, chromosome 10 at 128,438,430 bp (GRCm38)
  • C to A, chromosome 11 at 43,730,478 bp (GRCm38)
  • T to A, chromosome 11 at 59,103,514 bp (GRCm38)
  • T to A, chromosome 11 at 69,185,124 bp (GRCm38)
  • T to C, chromosome 11 at 86,308,901 bp (GRCm38)
  • T to A, chromosome 11 at 99,012,144 bp (GRCm38)
  • A to T, chromosome 11 at 107,173,452 bp (GRCm38)
  • A to T, chromosome 12 at 31,626,757 bp (GRCm38)
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp (GRCm38)
  • G to A, chromosome 13 at 81,543,378 bp (GRCm38)
  • T to A, chromosome 14 at 7,594,512 bp (GRCm38)
  • T to G, chromosome 14 at 45,278,772 bp (GRCm38)
  • T to A, chromosome 14 at 77,091,968 bp (GRCm38)
  • A to C, chromosome 15 at 12,374,535 bp (GRCm38)
  • A to G, chromosome 15 at 32,679,227 bp (GRCm38)
  • T to C, chromosome 15 at 63,830,829 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,284 bp (GRCm38)
  • A to G, chromosome 15 at 96,590,084 bp (GRCm38)
  • C to T, chromosome 16 at 19,530,276 bp (GRCm38)
  • A to G, chromosome 16 at 34,034,494 bp (GRCm38)
  • T to G, chromosome 16 at 77,055,188 bp (GRCm38)
  • C to A, chromosome 17 at 12,507,170 bp (GRCm38)
  • T to A, chromosome 17 at 34,381,144 bp (GRCm38)
  • T to A, chromosome 17 at 65,835,078 bp (GRCm38)
  • G to A, chromosome 19 at 13,282,194 bp (GRCm38)
  • A to G, chromosome 19 at 47,267,171 bp (GRCm38)
  • A to G, chromosome 19 at 47,785,375 bp (GRCm38)
  • A to G, chromosome 19 at 56,306,821 bp (GRCm38)
  • A to G, chromosome 19 at 56,723,393 bp (GRCm38)
  • A to T, chromosome Y at 1,432,188 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9515 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069317-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.