Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9516Btlr/Mmmh
Stock Number:
069318-MU
Citation ID:
RRID:MMRRC_069318-MU
Other Names:
R9516 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Zfp97
Name: zinc finger protein 97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22759
Homologene: 133884
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 21,249,836 bp (GRCm38)
  • T to A, chromosome 1 at 43,978,488 bp (GRCm38)
  • T to A, chromosome 1 at 44,167,881 bp (GRCm38)
  • A to T, chromosome 1 at 84,757,494 bp (GRCm38)
  • T to G, chromosome 1 at 118,503,830 bp (GRCm38)
  • G to A, chromosome 1 at 191,349,807 bp (GRCm38)
  • A to G, chromosome 2 at 30,953,173 bp (GRCm38)
  • T to A, chromosome 2 at 76,946,760 bp (GRCm38)
  • A to C, chromosome 2 at 103,733,019 bp (GRCm38)
  • C to G, chromosome 2 at 120,704,083 bp (GRCm38)
  • A to C, chromosome 2 at 128,675,713 bp (GRCm38)
  • A to T, chromosome 2 at 129,615,635 bp (GRCm38)
  • T to C, chromosome 2 at 150,311,202 bp (GRCm38)
  • A to G, chromosome 2 at 155,991,539 bp (GRCm38)
  • C to T, chromosome 2 at 180,474,150 bp (GRCm38)
  • A to G, chromosome 2 at 181,134,960 bp (GRCm38)
  • A to T, chromosome 3 at 56,029,945 bp (GRCm38)
  • G to A, chromosome 3 at 85,673,252 bp (GRCm38)
  • G to A, chromosome 3 at 94,700,045 bp (GRCm38)
  • T to C, chromosome 3 at 151,732,471 bp (GRCm38)
  • A to G, chromosome 4 at 62,542,679 bp (GRCm38)
  • G to T, chromosome 4 at 102,604,986 bp (GRCm38)
  • T to C, chromosome 4 at 108,848,279 bp (GRCm38)
  • T to A, chromosome 4 at 109,044,666 bp (GRCm38)
  • T to C, chromosome 4 at 112,158,039 bp (GRCm38)
  • C to T, chromosome 4 at 132,302,579 bp (GRCm38)
  • A to G, chromosome 4 at 133,258,980 bp (GRCm38)
  • G to T, chromosome 4 at 136,336,304 bp (GRCm38)
  • A to G, chromosome 4 at 148,484,646 bp (GRCm38)
  • A to G, chromosome 4 at 154,280,975 bp (GRCm38)
  • G to A, chromosome 5 at 21,811,339 bp (GRCm38)
  • A to G, chromosome 5 at 76,149,947 bp (GRCm38)
  • A to C, chromosome 5 at 76,229,380 bp (GRCm38)
  • A to T, chromosome 5 at 89,686,891 bp (GRCm38)
  • A to G, chromosome 5 at 113,614,280 bp (GRCm38)
  • A to G, chromosome 5 at 113,795,206 bp (GRCm38)
  • A to G, chromosome 6 at 42,435,373 bp (GRCm38)
  • T to C, chromosome 6 at 83,032,991 bp (GRCm38)
  • A to G, chromosome 6 at 85,467,643 bp (GRCm38)
  • T to C, chromosome 6 at 88,910,239 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,544 bp (GRCm38)
  • G to T, chromosome 6 at 116,640,304 bp (GRCm38)
  • T to A, chromosome 6 at 124,508,843 bp (GRCm38)
  • T to C, chromosome 6 at 136,908,068 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to G, chromosome 7 at 7,672,367 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • A to G, chromosome 7 at 46,138,005 bp (GRCm38)
  • T to C, chromosome 7 at 75,704,527 bp (GRCm38)
  • C to T, chromosome 7 at 140,898,542 bp (GRCm38)
  • A to G, chromosome 7 at 141,993,115 bp (GRCm38)
  • A to G, chromosome 8 at 36,140,054 bp (GRCm38)
  • A to G, chromosome 8 at 75,096,916 bp (GRCm38)
  • A to T, chromosome 8 at 88,670,422 bp (GRCm38)
  • A to G, chromosome 8 at 106,265,487 bp (GRCm38)
  • A to G, chromosome 8 at 109,721,224 bp (GRCm38)
  • G to T, chromosome 8 at 128,829,293 bp (GRCm38)
  • A to G, chromosome 9 at 54,027,493 bp (GRCm38)
  • A to G, chromosome 9 at 55,685,991 bp (GRCm38)
  • A to T, chromosome 9 at 62,428,009 bp (GRCm38)
  • A to T, chromosome 9 at 73,484,938 bp (GRCm38)
  • A to G, chromosome 9 at 106,238,641 bp (GRCm38)
  • T to A, chromosome 10 at 14,129,779 bp (GRCm38)
  • T to C, chromosome 10 at 18,018,883 bp (GRCm38)
  • T to C, chromosome 10 at 27,224,019 bp (GRCm38)
  • T to C, chromosome 10 at 91,079,954 bp (GRCm38)
  • A to G, chromosome 10 at 95,496,822 bp (GRCm38)
  • T to A, chromosome 10 at 109,684,154 bp (GRCm38)
  • A to T, chromosome 10 at 112,200,732 bp (GRCm38)
  • T to A, chromosome 11 at 43,230,397 bp (GRCm38)
  • T to A, chromosome 11 at 54,691,343 bp (GRCm38)
  • A to T, chromosome 11 at 67,248,464 bp (GRCm38)
  • T to A, chromosome 11 at 67,250,303 bp (GRCm38)
  • T to C, chromosome 11 at 71,107,662 bp (GRCm38)
  • A to G, chromosome 11 at 75,468,286 bp (GRCm38)
  • G to T, chromosome 11 at 76,419,832 bp (GRCm38)
  • A to T, chromosome 11 at 86,288,975 bp (GRCm38)
  • T to C, chromosome 11 at 102,202,696 bp (GRCm38)
  • C to A, chromosome 11 at 102,686,381 bp (GRCm38)
  • A to G, chromosome 11 at 108,757,688 bp (GRCm38)
  • A to G, chromosome 11 at 119,542,555 bp (GRCm38)
  • T to C, chromosome 12 at 85,747,180 bp (GRCm38)
  • A to T, chromosome 12 at 115,952,946 bp (GRCm38)
  • A to G, chromosome 13 at 55,524,373 bp (GRCm38)
  • A to T, chromosome 13 at 65,036,226 bp (GRCm38)
  • A to G, chromosome 13 at 68,572,636 bp (GRCm38)
  • A to G, chromosome 13 at 109,260,662 bp (GRCm38)
  • A to T, chromosome 13 at 113,319,115 bp (GRCm38)
  • G to A, chromosome 14 at 20,523,800 bp (GRCm38)
  • T to C, chromosome 14 at 52,463,416 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,284 bp (GRCm38)
  • T to C, chromosome 15 at 89,300,539 bp (GRCm38)
  • T to A, chromosome 15 at 89,590,428 bp (GRCm38)
  • A to T, chromosome 15 at 101,861,344 bp (GRCm38)
  • A to G, chromosome 16 at 7,409,709 bp (GRCm38)
  • A to G, chromosome 16 at 34,034,494 bp (GRCm38)
  • T to C, chromosome 16 at 45,664,201 bp (GRCm38)
  • T to G, chromosome 16 at 77,055,188 bp (GRCm38)
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp (GRCm38)
  • T to A, chromosome 17 at 17,145,668 bp (GRCm38)
  • A to G, chromosome 17 at 31,603,209 bp (GRCm38)
  • G to A, chromosome 17 at 46,302,506 bp (GRCm38)
  • A to G, chromosome 17 at 84,610,812 bp (GRCm38)
  • C to T, chromosome 18 at 69,519,873 bp (GRCm38)
  • T to A, chromosome 19 at 18,596,371 bp (GRCm38)
  • T to A, chromosome Y at 3,774,888 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9516 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069318-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.