Strain Name:
C57BL/6J-MtgxR9516Btlr/Mmmh
Stock Number:
069318-MU
Citation ID:
RRID:MMRRC_069318-MU
Other Names:
R9516 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: 1110025P14Rik, D730040M03Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Zfp97
Name: zinc finger protein 97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22759
Homologene: 133884
Clasp1
Name: CLIP associating protein 1
Synonyms: CLASP1, 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Psmd13
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: S11, 26S proteasome subunit p40.5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23997
HGNC: HGNC:9558
Homologene: 2110
Kcnq2
Name: potassium voltage-gated channel, subfamily Q, member 2
Synonyms: KQT2, Nmf134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16536
HGNC: HGNC:6296
Homologene: 26174
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Hnrnpr
Name: heterogeneous nuclear ribonucleoprotein R
Synonyms: hnRNPR, 2610003J05Rik, Hnrpr, 2610528B01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74326
HGNC: HGNC:5047
Homologene: 4251
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Cct7
Name: chaperonin containing TCP1 subunit 7
Synonyms: Cctz, Ccth
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12468
HGNC: HGNC:1622
Homologene: 4694
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Tcf4
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21413
Homologene: 2407
Nat10
Name: N-acetyltransferase 10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98956
Homologene: 6785
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Abr
Name: active BCR-related gene
Synonyms: 6330400K15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 109934
HGNC: HGNC:81
Homologene: 11081
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Tor1b
Name: torsin family 1, member B
Synonyms: DQ1, 2610016F05Rik, torsinB
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30934
Homologene: 56677
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, 1110067M05Rik, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Ppp3cb
Name: protein phosphatase 3, catalytic subunit, beta isoform
Synonyms: PP2BA beta, Calnb, CnAbeta, 1110063J16Rik, Cnab
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19056
HGNC: HGNC:9315
Homologene: 56429
Ostf1
Name: osteoclast stimulating factor 1
Synonyms: SH3P2, C78236, Sh3d3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20409
HGNC: HGNC:8510
Homologene: 8227
Ccdc43
Name: coiled-coil domain containing 43
Synonyms: 2610001E01Rik, D11Ertd707e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52715
Homologene: 12074
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
3300002I08Rik
Name: RIKEN cDNA 3300002I08 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69277
Homologene: 137379
Abracl
Name: ABRA C-terminal like
Synonyms: 1700028I04Rik, 3110003A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73112
VEGA: 10
Homologene: 64011
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Tmem119
Name: transmembrane protein 119
Synonyms: obif
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231633
Homologene: 17145
Nptx1
Name: neuronal pentraxin 1
Synonyms: Np1, D11Bwg1004e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18164
HGNC: HGNC:7952
Homologene: 1891
Smpd3
Name: sphingomyelin phosphodiesterase 3, neutral
Synonyms: neutral sphingomyelinase II, nSMase2, 4631433G07Rik, fro, Nsm2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58994
Homologene: 10260
Pde4b
Name: phosphodiesterase 4B, cAMP specific
Synonyms: dunce, Dpde4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18578
HGNC: HGNC:8781
Homologene: 1953
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
C1rl
Name: complement component 1, r subcomponent-like
Synonyms: C1r-LP, C1rl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232371
Homologene: 9559
Sirpa
Name: signal-regulatory protein alpha
Synonyms: SIRP, P84, SHPS-1, Bit, CD172a, Idd13.2, Ptpns1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19261
HGNC: HGNC:9662
Homologene: 7246
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Spata31d1c
Name: spermatogenesis associated 31 subfamily D, member 1C
Synonyms: Fam75d1c, 4932441B19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238683
VEGA: 13
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Tmprss7
Name: transmembrane serine protease 7
Synonyms: LOC385645, B230219I23Rik, matriptase-3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208171
Homologene: 18178
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Atp10b
Name: ATPase, class V, type 10B
Synonyms: 5930426O13Rik, 9030605H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319767
Homologene: 70969
Selenbp2
Name: selenium binding protein 2
Synonyms: acetaminophen-binding protein, AP56, Lpsb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20342
Homologene: 2930
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Tas2r126
Name: taste receptor, type 2, member 126
Synonyms: Tas2r26, mGR26, T2R12, mt2r35, T2R26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387353
Homologene: 16412
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: Gpcr27, ChemR23
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Rab42
Name: RAB42, member RAS oncogene family
Synonyms: 9530096D07Rik, Rab42-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242681
Homologene: 85237
Dlk2
Name: delta like non-canonical Notch ligand 2
Synonyms: Egfl9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106565
Homologene: 11397
Or4e1
Name: olfactory receptor family 4 subfamily E member 1
Synonyms: GA_x6K02T2RJGY-520647-521579, MOR244-4, MOR244-2, MOR10, Olfr1508
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57270
HGNC: HGNC:8296
Homologene: 10737
Ifi44
Name: interferon-induced protein 44
Synonyms: p44, MTAP44, A430056A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99899
Homologene: 4683
Nrdc
Name: nardilysin convertase
Synonyms: NRD-C, Nrd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230598
HGNC: HGNC:7995
Homologene: 68260
Sytl1
Name: synaptotagmin-like 1
Synonyms: Slp1, PSGL-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269589
Homologene: 12853
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
4933430I17Rik
Name: RIKEN cDNA 4933430I17 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214106
Homologene: 51897
Zfp821
Name: zinc finger protein 821
Synonyms: 4930566A11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75871
Homologene: 32345
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Nlrc2, Card15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Gsta3
Name: glutathione S-transferase, alpha 3
Synonyms: Gst2-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14859
Homologene: 37355
Prag1
Name: PEAK1 related kinase activating pseudokinase 1
Synonyms: NACK, D8Ertd82e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244418
Homologene: 18256
Rabl2
Name: RAB, member RAS oncogene family-like 2
Synonyms: 1110031N17Rik, Rabl2a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68708
Homologene: 90913
Cep250
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Brsk2
Name: BR serine/threonine kinase 2
Synonyms: SAD-A, 4833424K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75770
Homologene: 123829
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Coro2b
Name: coronin, actin binding protein, 2B
Synonyms: E130012P22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235431
HGNC: HGNC:2256
Homologene: 21228
Erp27
Name: endoplasmic reticulum protein 27
Synonyms: 1810047B09Rik, 1810033M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69187
Homologene: 12303
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Skint4
Name: selection and upkeep of intraepithelial T cells 4
Synonyms: 9530098N22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320640
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Arhgef16
Name: Rho guanine nucleotide exchange factor 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230972
Homologene: 82484
Tpra1
Name: transmembrane protein, adipocyte asscociated 1
Synonyms: Tpra40, 40kDa, Gpr175
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 24100
Homologene: 40799
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Rassf4
Name: Ras association (RalGDS/AF-6) domain family member 4
Synonyms: 3830411C14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213391
Homologene: 12926
Caps2
Name: calcyphosphine 2
Synonyms: D630005B03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353025
Homologene: 72278
Dok3
Name: docking protein 3
Synonyms: p62Dok-like protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27261
VEGA: 13
Homologene: 8448
Rbfox1
Name: RNA binding protein, fox-1 homolog (C. elegans) 1
Synonyms: A2bp, HRNBP1, FOX1, A2bp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268859
VEGA: 16
Homologene: 69339
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Tnfaip8l3
Name: tumor necrosis factor, alpha-induced protein 8-like 3
Synonyms: LOC244882, 9930029P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244882
VEGA: 9
Homologene: 19480
Pacc1
Name: proton activated chloride channel 1
Synonyms: 2310028N02Rik, Tmem206
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66950
Homologene: 10097
Mrpl42
Name: mitochondrial ribosomal protein L42
Synonyms: MRP-L31, Rpml31, PTD007, HSPC204, 2700009F22Rik, 2900055D03Rik, D10Ertd322e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67270
VEGA: 10
Homologene: 12106
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Flvcr2
Name: feline leukemia virus subgroup C cellular receptor 2
Synonyms: CCT, Mfsd7c
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217721
VEGA: 12
Homologene: 9840
Ighv1-82
Name: immunoglobulin heavy variable 1-82
Synonyms: Gm16747
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100775175
HGNC: HGNC:5553
Tlcd2
Name: TLC domain containing 2
Synonyms: 2010305C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380712
Homologene: 57070
Vmn2r34
Name: vomeronasal 2, receptor 34
Synonyms: ENSMUSG00000070841
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042636
Homologene: 113703
Rbmyf9
Name: RNA binding motif protein Y-linked family member 9
Synonyms: Gm3376
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 100041505
Homologene: 136626
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 21,249,836 bp (GRCm38)
  • T to A, chromosome 1 at 43,978,488 bp (GRCm38)
  • T to A, chromosome 1 at 44,167,881 bp (GRCm38)
  • A to T, chromosome 1 at 84,757,494 bp (GRCm38)
  • T to G, chromosome 1 at 118,503,830 bp (GRCm38)
  • G to A, chromosome 1 at 191,349,807 bp (GRCm38)
  • A to G, chromosome 2 at 30,953,173 bp (GRCm38)
  • T to A, chromosome 2 at 76,946,760 bp (GRCm38)
  • A to C, chromosome 2 at 103,733,019 bp (GRCm38)
  • C to G, chromosome 2 at 120,704,083 bp (GRCm38)
  • A to C, chromosome 2 at 128,675,713 bp (GRCm38)
  • A to T, chromosome 2 at 129,615,635 bp (GRCm38)
  • T to C, chromosome 2 at 150,311,202 bp (GRCm38)
  • A to G, chromosome 2 at 155,991,539 bp (GRCm38)
  • C to T, chromosome 2 at 180,474,150 bp (GRCm38)
  • A to G, chromosome 2 at 181,134,960 bp (GRCm38)
  • A to T, chromosome 3 at 56,029,945 bp (GRCm38)
  • G to A, chromosome 3 at 85,673,252 bp (GRCm38)
  • G to A, chromosome 3 at 94,700,045 bp (GRCm38)
  • T to C, chromosome 3 at 151,732,471 bp (GRCm38)
  • A to G, chromosome 4 at 62,542,679 bp (GRCm38)
  • G to T, chromosome 4 at 102,604,986 bp (GRCm38)
  • T to C, chromosome 4 at 108,848,279 bp (GRCm38)
  • T to A, chromosome 4 at 109,044,666 bp (GRCm38)
  • T to C, chromosome 4 at 112,158,039 bp (GRCm38)
  • C to T, chromosome 4 at 132,302,579 bp (GRCm38)
  • A to G, chromosome 4 at 133,258,980 bp (GRCm38)
  • G to T, chromosome 4 at 136,336,304 bp (GRCm38)
  • A to G, chromosome 4 at 148,484,646 bp (GRCm38)
  • A to G, chromosome 4 at 154,280,975 bp (GRCm38)
  • G to A, chromosome 5 at 21,811,339 bp (GRCm38)
  • A to G, chromosome 5 at 76,149,947 bp (GRCm38)
  • A to C, chromosome 5 at 76,229,380 bp (GRCm38)
  • A to T, chromosome 5 at 89,686,891 bp (GRCm38)
  • A to G, chromosome 5 at 113,614,280 bp (GRCm38)
  • A to G, chromosome 5 at 113,795,206 bp (GRCm38)
  • A to G, chromosome 6 at 42,435,373 bp (GRCm38)
  • T to C, chromosome 6 at 83,032,991 bp (GRCm38)
  • A to G, chromosome 6 at 85,467,643 bp (GRCm38)
  • T to C, chromosome 6 at 88,910,239 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,544 bp (GRCm38)
  • G to T, chromosome 6 at 116,640,304 bp (GRCm38)
  • T to A, chromosome 6 at 124,508,843 bp (GRCm38)
  • T to C, chromosome 6 at 136,908,068 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to G, chromosome 7 at 7,672,367 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • A to G, chromosome 7 at 46,138,005 bp (GRCm38)
  • T to C, chromosome 7 at 75,704,527 bp (GRCm38)
  • C to T, chromosome 7 at 140,898,542 bp (GRCm38)
  • A to G, chromosome 7 at 141,993,115 bp (GRCm38)
  • A to G, chromosome 8 at 36,140,054 bp (GRCm38)
  • A to G, chromosome 8 at 75,096,916 bp (GRCm38)
  • A to T, chromosome 8 at 88,670,422 bp (GRCm38)
  • A to G, chromosome 8 at 106,265,487 bp (GRCm38)
  • A to G, chromosome 8 at 109,721,224 bp (GRCm38)
  • G to T, chromosome 8 at 128,829,293 bp (GRCm38)
  • A to G, chromosome 9 at 54,027,493 bp (GRCm38)
  • A to G, chromosome 9 at 55,685,991 bp (GRCm38)
  • A to T, chromosome 9 at 62,428,009 bp (GRCm38)
  • A to T, chromosome 9 at 73,484,938 bp (GRCm38)
  • A to G, chromosome 9 at 106,238,641 bp (GRCm38)
  • T to A, chromosome 10 at 14,129,779 bp (GRCm38)
  • T to C, chromosome 10 at 18,018,883 bp (GRCm38)
  • T to C, chromosome 10 at 27,224,019 bp (GRCm38)
  • T to C, chromosome 10 at 91,079,954 bp (GRCm38)
  • A to G, chromosome 10 at 95,496,822 bp (GRCm38)
  • T to A, chromosome 10 at 109,684,154 bp (GRCm38)
  • A to T, chromosome 10 at 112,200,732 bp (GRCm38)
  • T to A, chromosome 11 at 43,230,397 bp (GRCm38)
  • T to A, chromosome 11 at 54,691,343 bp (GRCm38)
  • A to T, chromosome 11 at 67,248,464 bp (GRCm38)
  • T to A, chromosome 11 at 67,250,303 bp (GRCm38)
  • T to C, chromosome 11 at 71,107,662 bp (GRCm38)
  • A to G, chromosome 11 at 75,468,286 bp (GRCm38)
  • G to T, chromosome 11 at 76,419,832 bp (GRCm38)
  • A to T, chromosome 11 at 86,288,975 bp (GRCm38)
  • T to C, chromosome 11 at 102,202,696 bp (GRCm38)
  • C to A, chromosome 11 at 102,686,381 bp (GRCm38)
  • A to G, chromosome 11 at 108,757,688 bp (GRCm38)
  • A to G, chromosome 11 at 119,542,555 bp (GRCm38)
  • T to C, chromosome 12 at 85,747,180 bp (GRCm38)
  • A to T, chromosome 12 at 115,952,946 bp (GRCm38)
  • A to G, chromosome 13 at 55,524,373 bp (GRCm38)
  • A to T, chromosome 13 at 65,036,226 bp (GRCm38)
  • A to G, chromosome 13 at 68,572,636 bp (GRCm38)
  • A to G, chromosome 13 at 109,260,662 bp (GRCm38)
  • A to T, chromosome 13 at 113,319,115 bp (GRCm38)
  • G to A, chromosome 14 at 20,523,800 bp (GRCm38)
  • T to C, chromosome 14 at 52,463,416 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,284 bp (GRCm38)
  • T to C, chromosome 15 at 89,300,539 bp (GRCm38)
  • T to A, chromosome 15 at 89,590,428 bp (GRCm38)
  • A to T, chromosome 15 at 101,861,344 bp (GRCm38)
  • A to G, chromosome 16 at 7,409,709 bp (GRCm38)
  • A to G, chromosome 16 at 34,034,494 bp (GRCm38)
  • T to C, chromosome 16 at 45,664,201 bp (GRCm38)
  • T to G, chromosome 16 at 77,055,188 bp (GRCm38)
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp (GRCm38)
  • T to A, chromosome 17 at 17,145,668 bp (GRCm38)
  • A to G, chromosome 17 at 31,603,209 bp (GRCm38)
  • G to A, chromosome 17 at 46,302,506 bp (GRCm38)
  • A to G, chromosome 17 at 84,610,812 bp (GRCm38)
  • C to T, chromosome 18 at 69,519,873 bp (GRCm38)
  • T to A, chromosome 19 at 18,596,371 bp (GRCm38)
  • T to A, chromosome Y at 3,774,888 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9516 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069318-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.