Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9576Btlr/Mmmh
Stock Number:
069369-MU
Citation ID:
RRID:MMRRC_069369-MU
Other Names:
R9576 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Nudc
Name: nudC nuclear distribution protein
Synonyms: NudC, Silg92
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18221
HGNC: HGNC:8045
Homologene: 4812
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233765
Homologene: 52172
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 54,368,385 bp (GRCm38)
  • G to T, chromosome 1 at 60,409,849 bp (GRCm38)
  • T to C, chromosome 1 at 65,080,527 bp (GRCm38)
  • A to T, chromosome 1 at 74,747,923 bp (GRCm38)
  • A to G, chromosome 1 at 123,341,680 bp (GRCm38)
  • T to A, chromosome 1 at 136,416,943 bp (GRCm38)
  • CAAA to CAA, chromosome 1 at 189,256,694 bp (GRCm38)
  • T to A, chromosome 2 at 34,983,755 bp (GRCm38)
  • A to T, chromosome 3 at 32,914,986 bp (GRCm38)
  • G to A, chromosome 4 at 28,870,659 bp (GRCm38)
  • T to C, chromosome 4 at 63,133,045 bp (GRCm38)
  • T to C, chromosome 4 at 133,535,678 bp (GRCm38)
  • C to T, chromosome 4 at 155,862,365 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • T to G, chromosome 5 at 88,526,117 bp (GRCm38)
  • A to T, chromosome 5 at 106,874,072 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • T to C, chromosome 6 at 106,735,727 bp (GRCm38)
  • T to A, chromosome 6 at 119,220,032 bp (GRCm38)
  • C to A, chromosome 6 at 128,412,987 bp (GRCm38)
  • A to T, chromosome 6 at 146,311,007 bp (GRCm38)
  • C to A, chromosome 6 at 146,609,837 bp (GRCm38)
  • T to C, chromosome 7 at 10,037,263 bp (GRCm38)
  • C to A, chromosome 7 at 25,097,144 bp (GRCm38)
  • A to T, chromosome 7 at 44,211,053 bp (GRCm38)
  • T to C, chromosome 7 at 105,086,553 bp (GRCm38)
  • T to C, chromosome 7 at 116,129,434 bp (GRCm38)
  • A to T, chromosome 7 at 133,014,469 bp (GRCm38)
  • A to G, chromosome 7 at 139,020,259 bp (GRCm38)
  • C to A, chromosome 8 at 24,955,937 bp (GRCm38)
  • T to A, chromosome 8 at 90,932,666 bp (GRCm38)
  • T to A, chromosome 8 at 111,041,664 bp (GRCm38)
  • C to A, chromosome 9 at 51,119,136 bp (GRCm38)
  • C to A, chromosome 9 at 106,068,072 bp (GRCm38)
  • A to G, chromosome 9 at 110,087,644 bp (GRCm38)
  • G to A, chromosome 9 at 121,642,927 bp (GRCm38)
  • T to A, chromosome 10 at 8,744,535 bp (GRCm38)
  • C to T, chromosome 10 at 21,154,713 bp (GRCm38)
  • A to T, chromosome 10 at 22,702,105 bp (GRCm38)
  • T to C, chromosome 10 at 50,618,158 bp (GRCm38)
  • C to T, chromosome 11 at 4,941,222 bp (GRCm38)
  • T to A, chromosome 11 at 46,778,564 bp (GRCm38)
  • T to C, chromosome 11 at 67,764,796 bp (GRCm38)
  • T to A, chromosome 11 at 69,108,029 bp (GRCm38)
  • C to T, chromosome 11 at 72,037,427 bp (GRCm38)
  • T to A, chromosome 11 at 77,819,001 bp (GRCm38)
  • T to A, chromosome 11 at 82,987,385 bp (GRCm38)
  • G to A, chromosome 11 at 86,702,411 bp (GRCm38)
  • T to C, chromosome 11 at 96,581,204 bp (GRCm38)
  • A to T, chromosome 12 at 74,897,533 bp (GRCm38)
  • T to C, chromosome 12 at 100,945,490 bp (GRCm38)
  • T to A, chromosome 12 at 102,369,330 bp (GRCm38)
  • A to G, chromosome 12 at 104,268,471 bp (GRCm38)
  • T to C, chromosome 13 at 81,543,489 bp (GRCm38)
  • T to G, chromosome 14 at 70,318,786 bp (GRCm38)
  • C to T, chromosome 15 at 28,272,140 bp (GRCm38)
  • C to A, chromosome 15 at 76,231,177 bp (GRCm38)
  • T to C, chromosome 15 at 78,960,066 bp (GRCm38)
  • T to A, chromosome 15 at 79,251,982 bp (GRCm38)
  • T to A, chromosome 15 at 82,063,642 bp (GRCm38)
  • T to A, chromosome 15 at 91,752,185 bp (GRCm38)
  • T to A, chromosome 15 at 101,811,357 bp (GRCm38)
  • A to T, chromosome 15 at 103,035,958 bp (GRCm38)
  • A to T, chromosome 16 at 4,483,167 bp (GRCm38)
  • C to T, chromosome 16 at 17,276,662 bp (GRCm38)
  • A to T, chromosome 16 at 19,624,211 bp (GRCm38)
  • A to G, chromosome 16 at 44,837,975 bp (GRCm38)
  • C to A, chromosome 17 at 20,846,901 bp (GRCm38)
  • G to A, chromosome 17 at 35,394,437 bp (GRCm38)
  • T to C, chromosome 17 at 80,434,938 bp (GRCm38)
  • T to A, chromosome 18 at 39,120,154 bp (GRCm38)
  • A to T, chromosome 19 at 46,259,683 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9576 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069369-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.