Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9587Btlr/Mmmh
Stock Number:
069380-MU
Citation ID:
RRID:MMRRC_069380-MU
Other Names:
R9587 (G1)
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: D030046F20Rik, 2810017I02Rik, 1110061A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Gga3
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms: C230037M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 260302
Homologene: 121703
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100502698
Homologene: 15687
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 134,407,649 bp (GRCm38)
  • T to A, chromosome 2 at 76,794,632 bp (GRCm38)
  • A to T, chromosome 2 at 86,181,220 bp (GRCm38)
  • A to T, chromosome 2 at 87,753,840 bp (GRCm38)
  • T to C, chromosome 2 at 120,016,796 bp (GRCm38)
  • A to G, chromosome 2 at 144,065,532 bp (GRCm38)
  • C to T, chromosome 3 at 104,804,583 bp (GRCm38)
  • A to G, chromosome 3 at 105,916,772 bp (GRCm38)
  • G to A, chromosome 3 at 107,891,367 bp (GRCm38)
  • A to G, chromosome 4 at 63,133,679 bp (GRCm38)
  • G to A, chromosome 4 at 133,210,677 bp (GRCm38)
  • T to A, chromosome 5 at 4,069,149 bp (GRCm38)
  • A to G, chromosome 5 at 109,091,456 bp (GRCm38)
  • G to A, chromosome 5 at 129,541,363 bp (GRCm38)
  • T to A, chromosome 6 at 125,140,822 bp (GRCm38)
  • A to G, chromosome 6 at 148,869,002 bp (GRCm38)
  • A to G, chromosome 7 at 83,791,670 bp (GRCm38)
  • A to G, chromosome 8 at 69,743,042 bp (GRCm38)
  • G to A, chromosome 9 at 20,436,917 bp (GRCm38)
  • A to T, chromosome 10 at 79,379,102 bp (GRCm38)
  • T to A, chromosome 11 at 4,738,865 bp (GRCm38)
  • C to T, chromosome 11 at 49,341,180 bp (GRCm38)
  • T to C, chromosome 11 at 66,108,391 bp (GRCm38)
  • T to A, chromosome 11 at 67,211,370 bp (GRCm38)
  • G to A, chromosome 11 at 74,044,534 bp (GRCm38)
  • T to A, chromosome 11 at 99,283,627 bp (GRCm38)
  • T to C, chromosome 11 at 99,386,594 bp (GRCm38)
  • T to C, chromosome 11 at 99,879,310 bp (GRCm38)
  • T to C, chromosome 11 at 100,015,907 bp (GRCm38)
  • T to C, chromosome 11 at 115,590,891 bp (GRCm38)
  • G to T, chromosome 12 at 73,341,739 bp (GRCm38)
  • G to A, chromosome 13 at 27,383,618 bp (GRCm38)
  • T to C, chromosome 13 at 38,023,257 bp (GRCm38)
  • A to T, chromosome 13 at 67,491,704 bp (GRCm38)
  • T to A, chromosome 14 at 12,215,992 bp (GRCm38)
  • A to T, chromosome 14 at 33,047,273 bp (GRCm38)
  • C to T, chromosome 14 at 55,017,121 bp (GRCm38)
  • T to C, chromosome 15 at 53,092,412 bp (GRCm38)
  • A to G, chromosome 16 at 32,257,012 bp (GRCm38)
  • T to C, chromosome 16 at 32,843,309 bp (GRCm38)
  • T to C, chromosome 16 at 81,465,613 bp (GRCm38)
  • T to C, chromosome 17 at 22,202,783 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
  • A to G, chromosome 17 at 31,528,132 bp (GRCm38)
  • T to C, chromosome 17 at 35,898,290 bp (GRCm38)
  • A to G, chromosome 18 at 35,584,823 bp (GRCm38)
  • T to C, chromosome 18 at 46,175,655 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9587 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.