Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9587Btlr/Mmmh
Stock Number:
069380-MU
Citation ID:
RRID:MMRRC_069380-MU
Other Names:
R9587 (G1)
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: D030046F20Rik, 2810017I02Rik, 1110061A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Gga3
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms: C230037M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 260302
Homologene: 121703
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100502698
Homologene: 15687
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Sfswap
Name: splicing factor SWAP
Synonyms: 6330437E22Rik, 1190005N23Rik, Sfrs8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231769
Homologene: 134548
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Zfp26
Name: zinc finger protein 26
Synonyms: mkr-3, Zfp-26, 5033428C05Rik, Zfp70, KRAB15, Zfp81-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22688
Homologene: 52318
Ngdn
Name: neuroguidin, EIF4E binding protein
Synonyms: Ngd, neuroguidin, 1500001L15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68966
VEGA: 14
Homologene: 44286
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Krt33a
Name: keratin 33A
Synonyms: 2310015J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71888
Homologene: 74433
Krt10
Name: keratin 10
Synonyms: K10, K1C1, suprabasal cytokeratin 10, Krt-1.10, keratin 10, cytokeratin 10, D130054E02Rik, Krt1-10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16661
HGNC: HGNC:6413
Homologene: 137236
Cabp7
Name: calcium binding protein 7
Synonyms: calneuron II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192650
Homologene: 16364
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Nop2
Name: NOP2 nucleolar protein
Synonyms: 120kDa, Nol1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110109
HGNC: HGNC:7867
Homologene: 135865
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72017
Homologene: 96059
Caprin2
Name: caprin family member 2
Synonyms: Eeg1, C1qdc1, RNG140
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232560
Homologene: 11393
Slc38a6
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 625098
Homologene: 27550
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Wdr53
Name: WD repeat domain 53
Synonyms: 1500002B03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68980
Homologene: 15591
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Krt24
Name: keratin 24
Synonyms: 2310075C18Rik, 2310058N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75706
Homologene: 10379
Or2y17
Name: olfactory receptor family 2 subfamily Y member 17
Synonyms: GA_x6K02T2QP88-6094111-6093176, MOR256-2, Olfr1390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259068
Zfp963
Name: zinc finger protein 963
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 620419
Homologene: 49795
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: M5, MOR255-2, GA_x6K02T2P1NL-4202012-4201065, Olfr139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259005
Homologene: 77386
Zfp618
Name: zinc finger protein 618
Synonyms: D430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72701
Homologene: 18975
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Or8u8
Name: olfactory receptor family 8 subfamily U member 8
Synonyms: IE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963, Olfr52
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18352
Homologene: 105200
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Cfap161
Name: cilia and flagella associated protein 161
Synonyms: 1700026D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75556
Homologene: 12605
Zfp58
Name: zinc finger protein 58
Synonyms: Mfg-1, Mfg1, A530094I17Rik, Zfp817
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238693
Or5w17
Name: olfactory receptor family 5 subfamily W member 17
Synonyms: GA_x6K02T2Q125-49257818-49256883, MOR177-10, Olfr1141
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258630
Homologene: 74080
Prl2b1
Name: prolactin family 2, subfamily b, member 1
Synonyms: PLP-K, 2310047B08Rik, Prlpk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66392
Homologene: 11963
Atat1
Name: alpha tubulin acetyltransferase 1
Synonyms: 2610008K08Rik, 3110080J08Rik, 0610011P08Rik, 2610110G12Rik, MEC-17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73242
Homologene: 15129
Ndufv3
Name: NADH:ubiquinone oxidoreductase core subunit V3
Synonyms: 1500032D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78330
HGNC: HGNC:7719
Homologene: 10885
Banf2
Name: BANF family member 2
Synonyms: LOC228710, 4930517K23Rik, barrier to autointegration factor 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 403171
Homologene: 18671
Zfp994
Name: zinc finger protein 994
Synonyms: Gm4944
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240038
VEGA: 17
Homologene: 133246
Tmigd3
Name: transmembrane and immunoglobulin domain containing 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69296
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 134,407,649 bp (GRCm38)
  • T to A, chromosome 2 at 76,794,632 bp (GRCm38)
  • A to T, chromosome 2 at 86,181,220 bp (GRCm38)
  • A to T, chromosome 2 at 87,753,840 bp (GRCm38)
  • T to C, chromosome 2 at 120,016,796 bp (GRCm38)
  • A to G, chromosome 2 at 144,065,532 bp (GRCm38)
  • C to T, chromosome 3 at 104,804,583 bp (GRCm38)
  • A to G, chromosome 3 at 105,916,772 bp (GRCm38)
  • G to A, chromosome 3 at 107,891,367 bp (GRCm38)
  • A to G, chromosome 4 at 63,133,679 bp (GRCm38)
  • G to A, chromosome 4 at 133,210,677 bp (GRCm38)
  • T to A, chromosome 5 at 4,069,149 bp (GRCm38)
  • A to G, chromosome 5 at 109,091,456 bp (GRCm38)
  • G to A, chromosome 5 at 129,541,363 bp (GRCm38)
  • T to A, chromosome 6 at 125,140,822 bp (GRCm38)
  • A to G, chromosome 6 at 148,869,002 bp (GRCm38)
  • A to G, chromosome 7 at 83,791,670 bp (GRCm38)
  • A to G, chromosome 8 at 69,743,042 bp (GRCm38)
  • G to A, chromosome 9 at 20,436,917 bp (GRCm38)
  • A to T, chromosome 10 at 79,379,102 bp (GRCm38)
  • T to A, chromosome 11 at 4,738,865 bp (GRCm38)
  • C to T, chromosome 11 at 49,341,180 bp (GRCm38)
  • T to C, chromosome 11 at 66,108,391 bp (GRCm38)
  • T to A, chromosome 11 at 67,211,370 bp (GRCm38)
  • G to A, chromosome 11 at 74,044,534 bp (GRCm38)
  • T to A, chromosome 11 at 99,283,627 bp (GRCm38)
  • T to C, chromosome 11 at 99,386,594 bp (GRCm38)
  • T to C, chromosome 11 at 99,879,310 bp (GRCm38)
  • T to C, chromosome 11 at 100,015,907 bp (GRCm38)
  • T to C, chromosome 11 at 115,590,891 bp (GRCm38)
  • G to T, chromosome 12 at 73,341,739 bp (GRCm38)
  • G to A, chromosome 13 at 27,383,618 bp (GRCm38)
  • T to C, chromosome 13 at 38,023,257 bp (GRCm38)
  • A to T, chromosome 13 at 67,491,704 bp (GRCm38)
  • T to A, chromosome 14 at 12,215,992 bp (GRCm38)
  • A to T, chromosome 14 at 33,047,273 bp (GRCm38)
  • C to T, chromosome 14 at 55,017,121 bp (GRCm38)
  • T to C, chromosome 15 at 53,092,412 bp (GRCm38)
  • A to G, chromosome 16 at 32,257,012 bp (GRCm38)
  • T to C, chromosome 16 at 32,843,309 bp (GRCm38)
  • T to C, chromosome 16 at 81,465,613 bp (GRCm38)
  • T to C, chromosome 17 at 22,202,783 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
  • A to G, chromosome 17 at 31,528,132 bp (GRCm38)
  • T to C, chromosome 17 at 35,898,290 bp (GRCm38)
  • A to G, chromosome 18 at 35,584,823 bp (GRCm38)
  • T to C, chromosome 18 at 46,175,655 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9587 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.