Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9732Btlr/Mmmh
Stock Number:
069978-MU
Citation ID:
RRID:MMRRC_069978-MU
Other Names:
R9732 (G1)
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Akap10
Name: A kinase anchor protein 10
Synonyms: D-AKAP2, 1500031L16Rik, B130049N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56697
HGNC: HGNC:368
Homologene: 32452
Macroh2a1
Name: macroH2A.1 histone
Synonyms: mH2a1, MACROH2A1.2, H2AF12M, H2afy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to G, chromosome 1 at 117,986,109 bp (GRCm38)
  • A to T, chromosome 1 at 152,860,461 bp (GRCm38)
  • T to A, chromosome 1 at 175,899,499 bp (GRCm38)
  • C to T, chromosome 2 at 20,743,562 bp (GRCm38)
  • T to A, chromosome 2 at 59,308,453 bp (GRCm38)
  • T to G, chromosome 2 at 62,304,742 bp (GRCm38)
  • C to T, chromosome 2 at 76,938,862 bp (GRCm38)
  • T to A, chromosome 2 at 85,059,383 bp (GRCm38)
  • T to C, chromosome 2 at 87,711,145 bp (GRCm38)
  • C to A, chromosome 2 at 121,453,150 bp (GRCm38)
  • A to T, chromosome 2 at 145,616,671 bp (GRCm38)
  • T to G, chromosome 2 at 155,402,716 bp (GRCm38)
  • T to A, chromosome 2 at 160,892,276 bp (GRCm38)
  • G to A, chromosome 2 at 180,944,108 bp (GRCm38)
  • A to T, chromosome 3 at 19,661,875 bp (GRCm38)
  • T to A, chromosome 4 at 80,840,693 bp (GRCm38)
  • A to T, chromosome 4 at 156,173,989 bp (GRCm38)
  • T to C, chromosome 5 at 8,512,406 bp (GRCm38)
  • T to A, chromosome 5 at 16,615,750 bp (GRCm38)
  • A to T, chromosome 5 at 92,291,083 bp (GRCm38)
  • G to A, chromosome 5 at 114,063,081 bp (GRCm38)
  • T to C, chromosome 5 at 120,625,846 bp (GRCm38)
  • G to T, chromosome 5 at 121,254,191 bp (GRCm38)
  • C to T, chromosome 5 at 134,504,762 bp (GRCm38)
  • A to G, chromosome 5 at 146,216,121 bp (GRCm38)
  • G to A, chromosome 5 at 150,070,302 bp (GRCm38)
  • A to G, chromosome 5 at 150,405,293 bp (GRCm38)
  • T to A, chromosome 6 at 41,626,928 bp (GRCm38)
  • T to A, chromosome 6 at 91,784,705 bp (GRCm38)
  • C to T, chromosome 7 at 27,155,232 bp (GRCm38)
  • A to G, chromosome 7 at 67,735,904 bp (GRCm38)
  • C to A, chromosome 7 at 127,445,111 bp (GRCm38)
  • C to T, chromosome 8 at 3,476,167 bp (GRCm38)
  • C to T, chromosome 8 at 28,891,291 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • G to T, chromosome 8 at 95,338,747 bp (GRCm38)
  • G to T, chromosome 9 at 65,063,580 bp (GRCm38)
  • C to T, chromosome 9 at 95,405,898 bp (GRCm38)
  • T to A, chromosome 9 at 95,861,385 bp (GRCm38)
  • A to T, chromosome 9 at 108,082,226 bp (GRCm38)
  • A to G, chromosome 9 at 123,552,798 bp (GRCm38)
  • G to A, chromosome 10 at 19,357,403 bp (GRCm38)
  • T to A, chromosome 10 at 76,274,243 bp (GRCm38)
  • G to T, chromosome 10 at 77,759,313 bp (GRCm38)
  • G to C, chromosome 10 at 107,576,906 bp (GRCm38)
  • A to G, chromosome 10 at 128,363,647 bp (GRCm38)
  • G to T, chromosome 11 at 59,450,513 bp (GRCm38)
  • A to G, chromosome 11 at 60,749,565 bp (GRCm38)
  • G to A, chromosome 11 at 61,160,611 bp (GRCm38)
  • A to T, chromosome 11 at 61,896,719 bp (GRCm38)
  • G to A, chromosome 12 at 57,728,549 bp (GRCm38)
  • A to G, chromosome 12 at 113,088,576 bp (GRCm38)
  • A to T, chromosome 13 at 21,718,016 bp (GRCm38)
  • C to A, chromosome 13 at 22,827,209 bp (GRCm38)
  • GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA to GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA, chromosome 13 at 54,525,364 bp (GRCm38)
  • G to C, chromosome 13 at 56,096,163 bp (GRCm38)
  • G to A, chromosome 13 at 76,251,866 bp (GRCm38)
  • T to C, chromosome 14 at 31,368,074 bp (GRCm38)
  • T to C, chromosome 14 at 50,850,705 bp (GRCm38)
  • T to A, chromosome 14 at 60,796,188 bp (GRCm38)
  • G to T, chromosome 14 at 67,747,867 bp (GRCm38)
  • T to C, chromosome 14 at 103,211,313 bp (GRCm38)
  • T to A, chromosome 15 at 11,986,564 bp (GRCm38)
  • T to A, chromosome 15 at 65,848,290 bp (GRCm38)
  • C to A, chromosome 15 at 69,013,363 bp (GRCm38)
  • C to T, chromosome 15 at 77,735,366 bp (GRCm38)
  • T to C, chromosome 16 at 39,023,290 bp (GRCm38)
  • G to A, chromosome 16 at 66,731,411 bp (GRCm38)
  • G to A, chromosome 16 at 90,964,526 bp (GRCm38)
  • A to T, chromosome 17 at 46,188,071 bp (GRCm38)
  • G to A, chromosome 17 at 57,103,382 bp (GRCm38)
  • T to A, chromosome 18 at 47,248,858 bp (GRCm38)
  • A to T, chromosome 19 at 4,426,712 bp (GRCm38)
  • C to T, chromosome 19 at 5,081,909 bp (GRCm38)
  • A to G, chromosome 19 at 5,134,969 bp (GRCm38)
  • A to G, chromosome 19 at 34,952,953 bp (GRCm38)
  • A to G, chromosome 19 at 47,787,007 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9732 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069978-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.