Strain Name:
C57BL/6J-MtgxR9732Btlr/Mmmh
Stock Number:
069978-MU
Citation ID:
RRID:MMRRC_069978-MU
Other Names:
R9732 (G1)
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Akap10
Name: A kinase anchor protein 10
Synonyms: D-AKAP2, 1500031L16Rik, B130049N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56697
HGNC: HGNC:368
Homologene: 32452
Macroh2a1
Name: macroH2A.1 histone
Synonyms: mH2a1, MACROH2A1.2, H2AF12M, H2afy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Exo1
Name: exonuclease 1
Synonyms: Msa, 5730442G03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Ddx54
Name: DEAD box helicase 54
Synonyms: APR-5, DP97, 2410015A15Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71990
Homologene: 5590
Sdad1
Name: SDA1 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231452
Homologene: 6036
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Sub1
Name: SUB1 homolog, transcriptional regulator
Synonyms: P15, Pc4, Rpo2tc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20024
Homologene: 38218
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216825
Homologene: 52664
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Dpp8
Name: dipeptidylpeptidase 8
Synonyms: 4932434F09Rik, 2310004I03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74388
VEGA: 9
Homologene: 57098
Pacs1
Name: phosphofurin acidic cluster sorting protein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107975
VEGA: 19
Homologene: 9970
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Chst2
Name: carbohydrate sulfotransferase 2
Synonyms: N-acetylglucosamine-6-O-sulfotransferase, Gn6st, GST-2, C130041E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54371
HGNC: HGNC:1970
Homologene: 3150
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Rnf6
Name: ring finger protein (C3H2C3 type) 6
Synonyms: 5730419H05Rik, 1200013I08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74132
Homologene: 14036
Serinc4
Name: serine incorporator 4
Synonyms: A930015D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 574418
Homologene: 67424
Tnks1bp1
Name: tankyrase 1 binding protein 1
Synonyms: TAB182
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228140
Homologene: 14117
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Olig3
Name: oligodendrocyte transcription factor 3
Synonyms: Bhlhb7, bHLHe20
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94222
VEGA: 10
Homologene: 14201
Trim55
Name: tripartite motif-containing 55
Synonyms: D830041C10Rik, Murf2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381485
Homologene: 13205
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Khdrbs3
Name: KH domain containing, RNA binding, signal transduction associated 3
Synonyms: SLM-2, T-STAR, Etle, Salp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13992
VEGA: 15
Homologene: 4780
Capn7
Name: calpain 7
Synonyms: PalBH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12339
HGNC: HGNC:1484
Homologene: 7651
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Jmjd4
Name: jumonji domain containing 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 194952
Homologene: 11306
Cadm2
Name: cell adhesion molecule 2
Synonyms: A830029E02Rik, Necl3, SynCAM2, Igsf4d, 2900078E11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239857
Homologene: 17705
Unc5d
Name: unc-5 netrin receptor D
Synonyms: Unc5h4, D930029E11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 210801
Homologene: 15450
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Tex22
Name: testis expressed gene 22
Synonyms: Tep22, 1700028O09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75671
Homologene: 84861
Igsf11
Name: immunoglobulin superfamily, member 11
Synonyms: BT-IgSF, 1700025L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207683
Homologene: 17613
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: Great, LGR8, Gpr106
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Vmn1r210
Name: vomeronasal 1 receptor 210
Synonyms: V1rh10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171269
Homologene: 110880
Slc24a3
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 3
Synonyms: NCKX3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94249
Homologene: 41390
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243547
Homologene: 16327
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Usb1
Name: U6 snRNA biogenesis 1
Synonyms: AA960436
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101985
Homologene: 11611
Mst1
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: DNF15S2h, D9H3F15S2, D3F15S2h, Hgfl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, 4931420H10Rik, Dip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Tmem151a
Name: transmembrane protein 151A
Synonyms: LOC381199, Tmem151, Gm30627
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381199
Homologene: 17721
Or5w14
Name: olfactory receptor family 5 subfamily W member 14
Synonyms: GA_x6K02T2Q125-49215724-49214792, MOR177-20, MOR40-9P, Olfr1137
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258101
Homologene: 79380
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Nkain4
Name: Na+/K+ transporting ATPase interacting 4
Synonyms: C030019F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58237
Homologene: 10978
Rundc3b
Name: RUN domain containing 3B
Synonyms: LOC242819
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242819
Homologene: 16286
Trpv6
Name: transient receptor potential cation channel, subfamily V, member 6
Synonyms: CaT1, Cac, CAT, Ecac2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64177
Homologene: 56812
Rhod
Name: ras homolog family member D
Synonyms: Arhd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11854
HGNC: HGNC:670
Homologene: 22409
Polh
Name: polymerase (DNA directed), eta (RAD 30 related)
Synonyms: RAD30A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 80905
VEGA: 17
HGNC: HGNC:9181
Homologene: 38189
Saxo5
Name: stabilizer of axonemal microtubules 5
Synonyms: 1700019B03Rik, Tex45
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76406
Homologene: 52367
Coq10a
Name: coenzyme Q10A
Synonyms: LOC210582
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210582
VEGA: 10
Homologene: 27027
Zfp689
Name: zinc finger protein 689
Synonyms: 4933416E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71131
Homologene: 16318
Gm11110
Name: predicted gene 11110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100169874
VEGA: 17
Apol9b
Name: apolipoprotein L 9b
Synonyms: 2310016F22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71898
VEGA: 15
Homologene: 77567
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Krtap10-21
Name: keratin associated protein 10-21
Synonyms: Gm3233
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041250
VEGA: 10
Homologene: 115744
Zfp658
Name: zinc finger protein 658
Synonyms: Gm7145
Type: Gene
Species: Mouse
Chromosome: 1
Homologene: 88945
Fam81b
Name: family with sequence similarity 81, member B
Synonyms: LOC238726
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238726
Homologene: 17616
Gnrh1
Name: gonadotropin releasing hormone 1
Synonyms: LNRH, LHRH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14714
VEGA: 14
HGNC: HGNC:4419
Homologene: 641
H3c10
Name: H3 clustered histone 10
Synonyms: H3-291, Hist1h3h
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319152
Homologene: 134113
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to G, chromosome 1 at 117,986,109 bp (GRCm38)
  • A to T, chromosome 1 at 152,860,461 bp (GRCm38)
  • T to A, chromosome 1 at 175,899,499 bp (GRCm38)
  • C to T, chromosome 2 at 20,743,562 bp (GRCm38)
  • T to A, chromosome 2 at 59,308,453 bp (GRCm38)
  • T to G, chromosome 2 at 62,304,742 bp (GRCm38)
  • C to T, chromosome 2 at 76,938,862 bp (GRCm38)
  • T to A, chromosome 2 at 85,059,383 bp (GRCm38)
  • T to C, chromosome 2 at 87,711,145 bp (GRCm38)
  • C to A, chromosome 2 at 121,453,150 bp (GRCm38)
  • A to T, chromosome 2 at 145,616,671 bp (GRCm38)
  • T to G, chromosome 2 at 155,402,716 bp (GRCm38)
  • T to A, chromosome 2 at 160,892,276 bp (GRCm38)
  • G to A, chromosome 2 at 180,944,108 bp (GRCm38)
  • A to T, chromosome 3 at 19,661,875 bp (GRCm38)
  • T to A, chromosome 4 at 80,840,693 bp (GRCm38)
  • A to T, chromosome 4 at 156,173,989 bp (GRCm38)
  • T to C, chromosome 5 at 8,512,406 bp (GRCm38)
  • T to A, chromosome 5 at 16,615,750 bp (GRCm38)
  • A to T, chromosome 5 at 92,291,083 bp (GRCm38)
  • G to A, chromosome 5 at 114,063,081 bp (GRCm38)
  • T to C, chromosome 5 at 120,625,846 bp (GRCm38)
  • G to T, chromosome 5 at 121,254,191 bp (GRCm38)
  • C to T, chromosome 5 at 134,504,762 bp (GRCm38)
  • A to G, chromosome 5 at 146,216,121 bp (GRCm38)
  • G to A, chromosome 5 at 150,070,302 bp (GRCm38)
  • A to G, chromosome 5 at 150,405,293 bp (GRCm38)
  • T to A, chromosome 6 at 41,626,928 bp (GRCm38)
  • T to A, chromosome 6 at 91,784,705 bp (GRCm38)
  • C to T, chromosome 7 at 27,155,232 bp (GRCm38)
  • A to G, chromosome 7 at 67,735,904 bp (GRCm38)
  • C to A, chromosome 7 at 127,445,111 bp (GRCm38)
  • C to T, chromosome 8 at 3,476,167 bp (GRCm38)
  • C to T, chromosome 8 at 28,891,291 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • G to T, chromosome 8 at 95,338,747 bp (GRCm38)
  • G to T, chromosome 9 at 65,063,580 bp (GRCm38)
  • C to T, chromosome 9 at 95,405,898 bp (GRCm38)
  • T to A, chromosome 9 at 95,861,385 bp (GRCm38)
  • A to T, chromosome 9 at 108,082,226 bp (GRCm38)
  • A to G, chromosome 9 at 123,552,798 bp (GRCm38)
  • G to A, chromosome 10 at 19,357,403 bp (GRCm38)
  • T to A, chromosome 10 at 76,274,243 bp (GRCm38)
  • G to T, chromosome 10 at 77,759,313 bp (GRCm38)
  • G to C, chromosome 10 at 107,576,906 bp (GRCm38)
  • A to G, chromosome 10 at 128,363,647 bp (GRCm38)
  • G to T, chromosome 11 at 59,450,513 bp (GRCm38)
  • A to G, chromosome 11 at 60,749,565 bp (GRCm38)
  • G to A, chromosome 11 at 61,160,611 bp (GRCm38)
  • A to T, chromosome 11 at 61,896,719 bp (GRCm38)
  • G to A, chromosome 12 at 57,728,549 bp (GRCm38)
  • A to G, chromosome 12 at 113,088,576 bp (GRCm38)
  • A to T, chromosome 13 at 21,718,016 bp (GRCm38)
  • C to A, chromosome 13 at 22,827,209 bp (GRCm38)
  • GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA to GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA, chromosome 13 at 54,525,364 bp (GRCm38)
  • G to C, chromosome 13 at 56,096,163 bp (GRCm38)
  • G to A, chromosome 13 at 76,251,866 bp (GRCm38)
  • T to C, chromosome 14 at 31,368,074 bp (GRCm38)
  • T to C, chromosome 14 at 50,850,705 bp (GRCm38)
  • T to A, chromosome 14 at 60,796,188 bp (GRCm38)
  • G to T, chromosome 14 at 67,747,867 bp (GRCm38)
  • T to C, chromosome 14 at 103,211,313 bp (GRCm38)
  • T to A, chromosome 15 at 11,986,564 bp (GRCm38)
  • T to A, chromosome 15 at 65,848,290 bp (GRCm38)
  • C to A, chromosome 15 at 69,013,363 bp (GRCm38)
  • C to T, chromosome 15 at 77,735,366 bp (GRCm38)
  • T to C, chromosome 16 at 39,023,290 bp (GRCm38)
  • G to A, chromosome 16 at 66,731,411 bp (GRCm38)
  • G to A, chromosome 16 at 90,964,526 bp (GRCm38)
  • A to T, chromosome 17 at 46,188,071 bp (GRCm38)
  • G to A, chromosome 17 at 57,103,382 bp (GRCm38)
  • T to A, chromosome 18 at 47,248,858 bp (GRCm38)
  • A to T, chromosome 19 at 4,426,712 bp (GRCm38)
  • C to T, chromosome 19 at 5,081,909 bp (GRCm38)
  • A to G, chromosome 19 at 5,134,969 bp (GRCm38)
  • A to G, chromosome 19 at 34,952,953 bp (GRCm38)
  • A to G, chromosome 19 at 47,787,007 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9732 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069978-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.