Strain Name:
C57BL/6J-MtgxR0686Btlr/Mmmh
Stock Number:
038871-MU
Citation ID:
RRID:MMRRC_038871-MU
Other Names:
R0686 (G1), C57BL/6J-MtgxR0686Btlr
Major Collection:

Strain Information

Ccne2
Name: cyclin E2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12448
HGNC: HGNC:1590
Homologene: 7660
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Arhgef12
Name: Rho guanine nucleotide exchange factor 12
Synonyms: LARG, 2310014B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69632
VEGA: 9
Homologene: 9088
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Prim2
Name: DNA primase, p58 subunit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19076
HGNC: HGNC:9370
Homologene: 731
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Kctd9
Name: potassium channel tetramerisation domain containing 9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105440
Homologene: 9754
Bsx
Name: brain specific homeobox
Synonyms: Bsx1b, Bsx1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244813
Homologene: 65347
Fhip1b
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 4632419K20Rik, 6530415H11Rik, Fam160a2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74349
Homologene: 75329
Ckb
Name: creatine kinase, brain
Synonyms: Ck-3, B-CK
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12709
VEGA: 12
HGNC: HGNC:1991
Homologene: 37530
Msh3
Name: mutS homolog 3
Synonyms: D13Em1, Rep-3, Rep3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17686
HGNC: HGNC:7326
Homologene: 1829
Sfrp2
Name: secreted frizzled-related protein 2
Synonyms: Sdf5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20319
Homologene: 56438
Cyp2r1
Name: cytochrome P450, family 2, subfamily r, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244209
Homologene: 75210
Ltbr
Name: lymphotoxin B receptor
Synonyms: TNFRrp, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Ltar, TNF-R-III, TNFCR, TNFR2-RP, LTbetaR, Tnfrsf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
1700123K08Rik
Name: RIKEN cDNA 1700123K08 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76658
Homologene: 86127
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Rasef
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242505
Homologene: 28424
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78937
Homologene: 62425
Eps8l1
Name: EPS8-like 1
Synonyms: 4632407K17Rik, EPS8R1, DRC3, 2310051G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67425
Homologene: 15767
Prss59
Name: serine protease 59
Synonyms: Tryx5, 1700074P13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73481
Homologene: 49905
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Fpr-rs4
Name: formyl peptide receptor, related sequence 4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14291
HGNC: HGNC:3827
Homologene: 130629
Eeig2
Name: EEIG family member 2
Synonyms: 1600010D10Rik, B430201A12Rik, Fam102b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329739
Homologene: 46568
Or2ag13
Name: olfactory receptor family 2 subfamily AG member 13
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6, Olfr695
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258591
Homologene: 133597
Paqr5
Name: progestin and adipoQ receptor family member V
Synonyms: 0610010I15Rik, mPRg
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74090
Homologene: 9788
Ces1a
Name: carboxylesterase 1A
Synonyms: Gm4976
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244595
HGNC: HGNC:1863
Homologene: 134142
Pih1d1
Name: PIH1 domain containing 1
Synonyms: 4933413A04Rik, 1110061L23Rik, Nop17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68845
Homologene: 9914
Or8g37
Name: olfactory receptor family 8 subfamily G member 37
Synonyms: GA_x6K02T2PVTD-33517322-33518257, MOR171-16, Olfr970
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258604
VEGA: 9
Homologene: 121532
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,514,189 bp
  • T to C, chromosome 3 at 83,769,412 bp
  • G to A, chromosome 3 at 108,992,685 bp
  • T to A, chromosome 4 at 11,197,220 bp
  • A to G, chromosome 4 at 73,734,534 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 5 at 124,747,718 bp
  • C to T, chromosome 5 at 138,564,537 bp
  • T to A, chromosome 6 at 11,997,011 bp
  • G to A, chromosome 6 at 40,928,518 bp
  • C to T, chromosome 6 at 56,728,594 bp
  • T to C, chromosome 6 at 125,308,061 bp
  • T to A, chromosome 7 at 4,477,450 bp
  • T to A, chromosome 7 at 45,156,329 bp
  • G to T, chromosome 7 at 105,388,309 bp
  • A to T, chromosome 7 at 106,714,378 bp
  • T to G, chromosome 7 at 114,552,011 bp
  • G to A, chromosome 7 at 127,972,763 bp
  • A to G, chromosome 8 at 93,022,449 bp
  • A to G, chromosome 8 at 110,564,015 bp
  • A to C, chromosome 9 at 39,819,668 bp
  • T to G, chromosome 9 at 40,876,437 bp
  • A to C, chromosome 9 at 42,993,028 bp
  • A to T, chromosome 9 at 54,904,176 bp
  • T to G, chromosome 9 at 61,972,794 bp
  • G to A, chromosome 11 at 98,158,404 bp
  • A to G, chromosome 12 at 111,670,193 bp
  • T to A, chromosome 13 at 23,034,792 bp
  • T to A, chromosome 13 at 54,525,190 bp
  • G to A, chromosome 13 at 92,351,431 bp
  • A to G, chromosome 14 at 67,728,736 bp
  • A to C, chromosome 17 at 18,022,351 bp
  • T to A, chromosome 19 at 41,582,372 bp
  • A to T, chromosome 19 at 56,856,051 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0686 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038871-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.