MMRRC:039817-MU

T to G, chromosome 1 at 40,607,741 bp
A to G, chromosome 1 at 58,169,843 bp
C to A, chromosome 1 at 133,279,365 bp
G to T, chromosome 1 at 150,604,831 bp
G to A, chromosome 2 at 30,827,076 bp
CAGAG to CAG, chromosome 2 at 35,122,806 bp
G to T, chromosome 2 at 36,087,458 bp
A to G, chromosome 2 at 36,480,047 bp
T to A, chromosome 2 at 49,758,805 bp
T to A, chromosome 2 at 76,586,214 bp
T to G, chromosome 2 at 131,516,207 bp
C to T, chromosome 2 at 150,816,772 bp
T to C, chromosome 2 at 153,906,861 bp
T to A, chromosome 2 at 160,896,809 bp
C to T, chromosome 2 at 181,391,431 bp
A to T, chromosome 3 at 75,908,149 bp
G to A, chromosome 3 at 87,810,572 bp
A to G, chromosome 3 at 103,874,052 bp
A to T, chromosome 3 at 104,818,116 bp
T to A, chromosome 4 at 43,665,537 bp
T to C, chromosome 4 at 106,762,035 bp
T to A, chromosome 4 at 126,745,273 bp
T to A, chromosome 4 at 139,423,945 bp
T to C, chromosome 4 at 139,644,128 bp
T to C, chromosome 4 at 141,021,802 bp
T to A, chromosome 5 at 29,474,189 bp
T to A, chromosome 5 at 31,058,072 bp
T to A, chromosome 5 at 72,696,579 bp
C to T, chromosome 5 at 114,263,132 bp
C to T, chromosome 5 at 139,426,722 bp
T to C, chromosome 5 at 139,547,547 bp
C to T, chromosome 5 at 144,174,988 bp
T to A, chromosome 5 at 144,208,645 bp
A to T, chromosome 6 at 11,900,575 bp
T to C, chromosome 6 at 128,491,161 bp
T to A, chromosome 6 at 128,576,260 bp
T to A, chromosome 7 at 48,824,644 bp
A to T, chromosome 7 at 62,377,738 bp
G to T, chromosome 7 at 75,611,434 bp
G to A, chromosome 7 at 78,477,935 bp
T to C, chromosome 7 at 118,794,575 bp
T to C, chromosome 7 at 130,892,253 bp
C to A, chromosome 7 at 143,592,474 bp
A to T, chromosome 8 at 25,164,493 bp
A to G, chromosome 8 at 72,058,436 bp
A to T, chromosome 8 at 111,297,402 bp
A to T, chromosome 8 at 128,498,516 bp
A to G, chromosome 9 at 7,081,084 bp
A to G, chromosome 9 at 36,909,684 bp
A to T, chromosome 9 at 39,772,495 bp
G to A, chromosome 9 at 44,819,675 bp
T to C, chromosome 9 at 72,308,005 bp
T to G, chromosome 10 at 4,519,043 bp
T to C, chromosome 10 at 11,609,325 bp
C to G, chromosome 10 at 13,182,536 bp
T to G, chromosome 10 at 18,524,664 bp
T to A, chromosome 10 at 25,993,927 bp
T to A, chromosome 10 at 81,278,054 bp
T to G, chromosome 10 at 127,011,892 bp
T to C, chromosome 11 at 5,977,880 bp
T to A, chromosome 11 at 59,013,801 bp
C to T, chromosome 11 at 59,076,759 bp
T to C, chromosome 11 at 60,707,240 bp
CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
G to C, chromosome 11 at 76,211,050 bp
T to C, chromosome 11 at 76,792,798 bp
G to A, chromosome 11 at 78,540,034 bp
T to A, chromosome 11 at 82,981,307 bp
C to T, chromosome 11 at 116,441,449 bp
T to A, chromosome 12 at 79,268,434 bp
A to G, chromosome 12 at 112,852,403 bp
C to T, chromosome 13 at 42,183,786 bp
T to A, chromosome 13 at 63,210,149 bp
A to T, chromosome 13 at 113,081,134 bp
A to T, chromosome 14 at 21,985,520 bp
A to T, chromosome 14 at 44,858,579 bp
A to T, chromosome 14 at 51,888,735 bp
A to G, chromosome 14 at 52,222,628 bp
T to C, chromosome 14 at 55,751,142 bp
A to G, chromosome 14 at 66,862,665 bp
G to A, chromosome 14 at 118,553,349 bp
A to G, chromosome 14 at 119,061,376 bp
A to G, chromosome 15 at 7,181,856 bp
A to G, chromosome 15 at 28,313,786 bp
A to G, chromosome 15 at 35,879,791 bp
G to A, chromosome 15 at 66,906,489 bp
A to G, chromosome 15 at 82,618,501 bp
A to G, chromosome 15 at 83,505,235 bp
T to A, chromosome 15 at 98,075,967 bp
A to T, chromosome 16 at 11,150,605 bp
A to T, chromosome 16 at 17,280,811 bp
T to C, chromosome 16 at 58,475,871 bp
G to T, chromosome 16 at 90,964,517 bp
T to C, chromosome 17 at 43,624,833 bp
T to C, chromosome 17 at 46,161,202 bp
T to C, chromosome 17 at 52,893,933 bp
A to G, chromosome 18 at 20,834,940 bp
A to G, chromosome 18 at 31,443,443 bp
T to C, chromosome 18 at 31,994,897 bp
T to C, chromosome 18 at 60,546,335 bp
A to T, chromosome 18 at 61,129,077 bp
A to T, chromosome 18 at 65,991,582 bp
T to C, chromosome 18 at 80,117,308 bp
T to C, chromosome 18 at 82,621,304 bp
T to G, chromosome 19 at 53,926,326 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R1786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
039817-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All