Strain Name:
C57BL/6J-MtgxR1876Btlr/Mmmh
Stock Number:
039898-MU
Citation ID:
RRID:MMRRC_039898-MU
Other Names:
R1876 (G1), C57BL/6J-MtgxR1876Btlr
Major Collection:

Strain Information

Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk2, Tsk-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Pepd
Name: peptidase D
Synonyms: Pep-4, peptidase D, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Strn4
Name: striatin, calmodulin binding protein 4
Synonyms: ZIN, zinedin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 97387
Homologene: 8378
Aasdh
Name: aminoadipate-semialdehyde dehydrogenase
Synonyms: A230062G08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231326
Homologene: 71711
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: A630020C16Rik, 4930502N04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Nisch
Name: nischarin
Synonyms: edsn, 3202002H23Rik, 1200007D05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Slc6a4
Name: solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms: Sert, Htt, 5-HTT
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15567
Homologene: 817
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, D130023A07Rik, 3110054G10Rik, Tnrc6, 2010321I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Hspa4
Name: heat shock protein 4
Synonyms: 70kDa, Hsp110, Hsp70RY, APG-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: Pptcs3, Pp6r3, 4930528G08Rik, Saps3, D19Bwg1430e, D19Ertd703e, 9130026N02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Ctc1
Name: CTS telomere maintenance complex component 1
Synonyms: 1500010J02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68964
Homologene: 11830
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Gpi1
Name: glucose-6-phosphate isomerase 1
Synonyms: Gpi-1s, Gpi-1t, Gpi-1, autocrine motility factor, AMF, NK, Gpi1-t, maturation factor, Org, neuroleukin, NK/GPI, Gpi-1r, MF, Gpi1-s, Gpi1-r
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14751
HGNC: HGNC:4458
Homologene: 145
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Gpat4
Name: glycerol-3-phosphate acyltransferase 4
Synonyms: Agpat6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102247
Homologene: 32425
Akap9
Name: A kinase anchor protein 9
Synonyms: G1-448-15, repro12, AKAP450, mei2-5, 5730481H23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Safb2
Name: scaffold attachment factor B2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224902
Homologene: 35210
Ice2
Name: interactor of little elongation complex ELL subunit 2
Synonyms: Narg2, B230343B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93697
Homologene: 11618
Chchd10
Name: coiled-coil-helix-coiled-coil-helix domain containing 10
Synonyms: Ndg2, 1620401E04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103172
VEGA: 10
Homologene: 27885
Cyb5r4
Name: cytochrome b5 reductase 4
Synonyms: B5+B5R, Ncb5or, b5/b5r, 2810034J18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 266690
Homologene: 69207
Pdcl
Name: phosducin-like
Synonyms: 1200011E13Rik, PhLP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67466
HGNC: HGNC:8770
Homologene: 38043
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243168
Homologene: 71549
Canx
Name: calnexin
Synonyms: 1110069N15Rik, CNX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12330
HGNC: HGNC:1473
Homologene: 1324
Pros1
Name: protein S (alpha)
Synonyms: protein S
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19128
HGNC: HGNC:9456
Homologene: 264
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Kirrel, Kirrel1, 6720469N11Rik, Neph1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: NRE, E430013P11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Rbm48
Name: RNA binding motif protein 48
Synonyms: C030048B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269623
Homologene: 12944
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: Evi-1, Jbo, ZNFPR1B1, D630039M04Rik, Prdm3, Mds1, Evi1, MDS1-EVI1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Fgf10
Name: fibroblast growth factor 10
Synonyms: Gsfaey17, AEY17, FGF-10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14165
HGNC: HGNC:3666
Homologene: 3284
Pink1
Name: PTEN induced putative kinase 1
Synonyms: 1190006F07Rik, brpk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68943
Homologene: 32672
Mslnl
Name: mesothelin-like
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328783
VEGA: 17
Homologene: 18633
Arap3
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: DRAG1, Centd3, E030006K04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106952
VEGA: 18
Homologene: 11199
Casp1
Name: caspase 1
Synonyms: Il1bc, Caspase-1, interleukin 1 beta-converting enzyme, ICE
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, 1110002J03Rik, B230219D21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Ush2a
Name: usherin
Synonyms: MUSH2A, LOC269160, Ush2a, A930037M10Rik, A930011D15Rik, LOC381317, Ushrn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: D130026O08Rik, Arhgap14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, SM1, smMHC
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Cyp2j7
Name: cytochrome P450, family 2, subfamily j, polypeptide 7
Synonyms: OTTMUSG00000007941, Cyp2j7-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546837
HGNC: HGNC:2634
Tmem125
Name: transmembrane protein 125
Synonyms: 6330530A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230678
Homologene: 16952
Hcrtr2
Name: hypocretin (orexin) receptor 2
Synonyms: mOX2aR, OX2r, mOXR2, mOX2bR
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 387285
HGNC: HGNC:4849
Homologene: 1168
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: zinc finger protein A20, Tnfip3, A20
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21929
Homologene: 4582
Man1a
Name: mannosidase 1, alpha
Synonyms: PCR1, mannosyl-oligosaccharide alpha-1,2-mannosidase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Plce1
Name: phospholipase C, epsilon 1
Synonyms: PLCepsilon, 4933403A21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Tigd4
Name: tigger transposable element derived 4
Synonyms: C130063O11Rik, Tigd4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 403175
Homologene: 131124
Scnn1a
Name: sodium channel, nonvoltage-gated 1 alpha
Synonyms: Scnn1, mENaC, ENaC alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20276
Homologene: 811
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Slc25a29
Name: solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
Synonyms: C030003J19Rik, CACL, mCACL
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214663
Homologene: 5385
Or1ak2
Name: olfactory receptor family 1 subfamily AK member 2
Synonyms: Olfr356, GA_x6K02T2NLDC-33631647-33632594, MOR134-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258617
Homologene: 85948
Lrrc49
Name: leucine rich repeat containing 49
Synonyms: D430025H09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102747
Homologene: 9782
Prpf19
Name: pre-mRNA processing factor 19
Synonyms: Prp19, PSO4, D19Wsu55e, Snev
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 28000
Homologene: 6421
Ptpre
Name: protein tyrosine phosphatase receptor type E
Synonyms: RPTPepsilon, PTPe, PTPepsilon
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Inpp5e
Name: inositol polyphosphate-5-phosphatase E
Synonyms: 1200002L24Rik, 72kDa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64436
Homologene: 56863
Ptk2b
Name: PTK2 protein tyrosine kinase 2 beta
Synonyms: Raftk, CAKbeta, cellular adhesion kinase beta, proline-rich tyrosine kinase 2, related adhesion focal tyrosine kinase, E430023O05Rik, PYK2, calcium-dependent tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19229
HGNC: HGNC:9612
Homologene: 23001
Plxnc1
Name: plexin C1
Synonyms: 2510048K12Rik, CD232, vespr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Grk5
Name: G protein-coupled receptor kinase 5
Synonyms: Gprk5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14773
VEGA: 19
HGNC: HGNC:4544
Homologene: 3879
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: 1700056N23Rik, 1700042F02Rik, SAPLT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Vmn2r65
Name: vomeronasal 2, receptor 65
Synonyms: ENSMUSG00000070600
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100009609
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, Dip2, 4931420H10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Gpcpd1
Name: glycerophosphocholine phosphodiesterase 1
Synonyms: 2310032D16Rik, Prei4, 2310004G06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74182
Homologene: 10478
Mrpl40
Name: mitochondrial ribosomal protein L40
Synonyms: Nlvcf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18100
Homologene: 2800
Vmn1r236
Name: vomeronasal 1 receptor 236
Synonyms: V1rf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171235
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: Adamts-14, TS14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Mup21
Name: major urinary protein 21
Synonyms: Gm11208
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381531
Homologene: 74304
Plrg1
Name: pleiotropic regulator 1
Synonyms: Tango4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53317
HGNC: HGNC:9089
Homologene: 2004
Tmem198
Name: transmembrane protein 198
Synonyms: Tmem198-1, Tmem198a, A230078I05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319998
Homologene: 44245
Ftcd
Name: formiminotransferase cyclodeaminase
Synonyms: glutamate formiminotransferase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14317
HGNC: HGNC:3974
Homologene: 4848
Nkain2
Name: Na+/K+ transporting ATPase interacting 2
Synonyms: Tcba1, 6330571D19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432450
Homologene: 65073
Ak1
Name: adenylate kinase 1
Synonyms: B430205N08Rik, Ak-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11636
HGNC: HGNC:361
Homologene: 20135
Or4k1
Name: olfactory receptor family 4 subfamily K member 1
Synonyms: GA_x6K02T2PMLR-5831021-5830086, MOR246-1P, Olfr728
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258039
Homologene: 74224
Btg4
Name: BTG anti-proliferation factor 4
Synonyms: PC3B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56057
VEGA: 9
Homologene: 9734
Cx3cl1
Name: C-X3-C motif chemokine ligand 1
Synonyms: D8Bwg0439e, CX3C, Scyd1, fractalkine, neurotactin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20312
Homologene: 2251
AC079644.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 45,342,235 bp
  • A to G, chromosome 1 at 75,484,923 bp
  • T to A, chromosome 1 at 188,678,289 bp
  • G to A, chromosome 2 at 25,040,973 bp
  • A to T, chromosome 2 at 26,408,157 bp
  • A to G, chromosome 2 at 32,630,270 bp
  • A to T, chromosome 2 at 36,937,763 bp
  • A to C, chromosome 2 at 37,355,696 bp
  • A to G, chromosome 2 at 132,534,753 bp
  • A to G, chromosome 3 at 29,993,658 bp
  • C to A, chromosome 3 at 83,069,068 bp
  • T to A, chromosome 3 at 84,593,935 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • C to T, chromosome 4 at 62,149,426 bp
  • T to C, chromosome 4 at 75,981,940 bp
  • T to C, chromosome 4 at 96,217,419 bp
  • T to C, chromosome 4 at 118,541,904 bp
  • T to A, chromosome 4 at 135,779,400 bp
  • A to G, chromosome 4 at 138,315,702 bp
  • C to T, chromosome 5 at 3,595,259 bp
  • T to A, chromosome 5 at 3,961,809 bp
  • T to A, chromosome 5 at 64,955,420 bp
  • C to A, chromosome 5 at 76,877,549 bp
  • T to A, chromosome 5 at 103,968,767 bp
  • A to G, chromosome 6 at 112,775,566 bp
  • A to G, chromosome 6 at 125,338,838 bp
  • T to A, chromosome 7 at 16,838,282 bp
  • G to A, chromosome 7 at 34,208,236 bp
  • T to C, chromosome 7 at 35,021,684 bp
  • T to A, chromosome 7 at 45,352,207 bp
  • A to T, chromosome 7 at 84,946,297 bp
  • A to G, chromosome 7 at 112,054,920 bp
  • A to C, chromosome 7 at 120,433,385 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • A to G, chromosome 7 at 128,752,851 bp
  • A to G, chromosome 7 at 130,623,745 bp
  • T to C, chromosome 7 at 135,678,317 bp
  • A to T, chromosome 8 at 23,179,470 bp
  • T to C, chromosome 8 at 94,780,420 bp
  • G to A, chromosome 9 at 5,303,663 bp
  • T to C, chromosome 9 at 51,117,189 bp
  • T to C, chromosome 9 at 60,587,777 bp
  • G to A, chromosome 9 at 69,415,575 bp
  • A to G, chromosome 9 at 76,246,345 bp
  • G to T, chromosome 9 at 79,678,281 bp
  • T to A, chromosome 9 at 87,055,814 bp
  • T to C, chromosome 10 at 18,597,356 bp
  • A to G, chromosome 10 at 19,004,934 bp
  • A to T, chromosome 10 at 30,698,126 bp
  • T to A, chromosome 10 at 32,890,439 bp
  • A to T, chromosome 10 at 53,919,172 bp
  • T to C, chromosome 10 at 61,200,372 bp
  • T to A, chromosome 10 at 75,936,332 bp
  • G to A, chromosome 10 at 76,318,091 bp
  • G to T, chromosome 10 at 76,581,569 bp
  • T to G, chromosome 10 at 80,530,078 bp
  • A to G, chromosome 10 at 94,866,941 bp
  • A to G, chromosome 11 at 50,304,359 bp
  • T to G, chromosome 11 at 53,284,156 bp
  • A to T, chromosome 11 at 69,031,564 bp
  • A to T, chromosome 11 at 77,015,164 bp
  • T to G, chromosome 12 at 88,084,040 bp
  • G to A, chromosome 12 at 108,827,711 bp
  • A to G, chromosome 13 at 118,789,159 bp
  • T to C, chromosome 14 at 31,173,637 bp
  • A to G, chromosome 14 at 50,140,172 bp
  • A to G, chromosome 14 at 66,158,392 bp
  • T to C, chromosome 15 at 12,257,630 bp
  • T to G, chromosome 15 at 58,106,868 bp
  • G to A, chromosome 16 at 14,269,103 bp
  • A to G, chromosome 16 at 18,872,474 bp
  • A to T, chromosome 16 at 62,903,518 bp
  • T to A, chromosome 17 at 21,286,638 bp
  • G to A, chromosome 17 at 25,742,934 bp
  • T to C, chromosome 17 at 56,576,909 bp
  • T to C, chromosome 18 at 37,974,609 bp
  • A to T, chromosome 19 at 3,471,971 bp
  • T to C, chromosome 19 at 10,900,225 bp
  • T to C, chromosome 19 at 38,780,623 bp
  • T to C, chromosome 19 at 61,083,225 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1876 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039898-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.