Strain Name:
C57BL/6J-MtgxR2911Btlr/Mmmh
Stock Number:
040498-MU
Citation ID:
RRID:MMRRC_040498-MU
Other Names:
R2911 (G1), C57BL/6J-MtgxR2911Btlr
Major Collection:

Strain Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Snx2
Name: sorting nexin 2
Synonyms: 0610030A03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67804
VEGA: 18
Homologene: 2332
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Ndc80
Name: NDC80 kinetochore complex component
Synonyms: HEC1, 2610020P18Rik, Kntc2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67052
VEGA: 17
Homologene: 38141
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Ddx1
Name: DEAD box helicase 1
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104721
VEGA: 12
HGNC: HGNC:2734
Homologene: 3627
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Fbxo38
Name: F-box protein 38
Synonyms: SP329, 6030410I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107035
VEGA: 18
Homologene: 34526
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Syt7
Name: synaptotagmin VII
Synonyms: B230112P13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54525
VEGA: 19
Homologene: 20889
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Grhl3
Name: grainyhead like transcription factor 3
Synonyms: Som, Get1, ct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230824
Homologene: 18864
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
Abcf3
Name: ATP-binding cassette, sub-family F member 3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Ythdc1
Name: YTH domain containing 1
Synonyms: A730098D12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231386
Homologene: 15796
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Tac1
Name: tachykinin 1
Synonyms: neurokinin 1, substance P, PPT-A, preprotachykinin A, neurokinin A, Nkna, NK1, 4930528L02Rik, SP, NK-1, PPTA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21333
Homologene: 2394
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Sox17
Name: SRY (sex determining region Y)-box 17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20671
Homologene: 7948
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP-76, twm, SLP76, m1Khoe
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Gbp5
Name: guanylate binding protein 5
Synonyms: 5330409J06Rik, Gbp5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229898
Homologene: 14183
Rubcnl
Name: RUN and cysteine rich domain containing beclin 1 interacting protein like
Synonyms: LOC380917, 5031414D18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271221
VEGA: 14
Homologene: 57021
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Phf11c
Name: PHD finger protein 11C
Synonyms: Gm6907
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 628705
Homologene: 87807
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Rin3
Name: Ras and Rab interactor 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217835
Homologene: 11748
Adam10
Name: a disintegrin and metallopeptidase domain 10
Synonyms: kuz, kuzbanian, 1700031C13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11487
HGNC: HGNC:188
Homologene: 865
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Acap1
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Synonyms: Centb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216859
Homologene: 22835
Lipo3
Name: lipase, member O3
Synonyms: Lipo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381236
Homologene: 103863
Or7e177
Name: olfactory receptor family 7 subfamily E member 177
Synonyms: GA_x6K02T2PVTD-14040245-14041204, MOR145-2, Olfr873
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258554
HGNC: HGNC:8396
Homologene: 115528
Cyp2c65
Name: cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms: 2210009K14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72303
Homologene: 133566
Card14
Name: caspase recruitment domain family, member 14
Synonyms: CARMA2, Bimp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170720
Homologene: 11469
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, D4Ertd800e, Ncoa6ip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Apbb3
Name: amyloid beta precursor protein binding family B member 3
Synonyms: TR2S, Rirl2, Fe65l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225372
VEGA: 18
Homologene: 21221
Dzip1l
Name: DAZ interacting protein 1-like
Synonyms: 2610524A10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72507
Homologene: 12466
Cyp4a12b
Name: cytochrome P450, family 4, subfamily a, polypeptide 12B
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13118
Homologene: 134044
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Or10d3
Name: olfactory receptor family 10 subfamily D member 3
Synonyms: GA_x6K02T2PVTD-33247839-33246901, MOR224-9, Olfr958
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258327
VEGA: 9
HGNC: HGNC:8168
Homologene: 27128
Lypd8l
Name: LY6/PLAUR domain containing 8 like
Synonyms: 2210407C18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78354
Homologene: 87212
Shcbp1l
Name: Shc SH2-domain binding protein 1-like
Synonyms: 1700012A16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71836
Homologene: 12800
Or5h25
Name: olfactory receptor family 5 subfamily H member 25
Synonyms: GA_x54KRFPKG5P-55338697-55337768, MOR183-7P, MOR113-7P, MOR113-7P, Olfr1540-ps1, Olfr193
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257972
Homologene: 128162
Reep2
Name: receptor accessory protein 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225362
VEGA: 18
Homologene: 41146
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Cnbd2
Name: cyclic nucleotide binding domain containing 2
Synonyms: 5430421B09Rik, 4921517L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70873
Homologene: 15440
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Spata21
Name: spermatogenesis associated 21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329972
Homologene: 18639
AL670114.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Tmem72
Name: transmembrane protein 72
Synonyms: C230095G01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319776
Homologene: 18704
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 4,493,131 bp
  • A to T, chromosome 1 at 53,427,824 bp
  • A to G, chromosome 1 at 130,849,533 bp
  • C to A, chromosome 1 at 153,428,626 bp
  • G to A, chromosome 1 at 175,785,615 bp
  • G to T, chromosome 1 at 183,096,344 bp
  • C to T, chromosome 2 at 3,438,107 bp
  • A to T, chromosome 2 at 24,607,541 bp
  • T to C, chromosome 2 at 41,506,692 bp
  • T to C, chromosome 2 at 129,101,274 bp
  • T to C, chromosome 2 at 156,353,190 bp
  • T to C, chromosome 2 at 157,469,384 bp
  • A to G, chromosome 3 at 142,506,701 bp
  • A to C, chromosome 3 at 145,124,323 bp
  • C to A, chromosome 4 at 3,585,616 bp
  • C to T, chromosome 4 at 62,697,344 bp
  • A to T, chromosome 4 at 115,433,526 bp
  • T to C, chromosome 4 at 135,559,146 bp
  • A to G, chromosome 4 at 141,103,082 bp
  • T to A, chromosome 4 at 153,995,427 bp
  • A to G, chromosome 5 at 62,621,979 bp
  • A to T, chromosome 5 at 63,794,345 bp
  • T to C, chromosome 5 at 73,050,456 bp
  • T to C, chromosome 5 at 86,816,559 bp
  • T to C, chromosome 5 at 92,194,181 bp
  • T to C, chromosome 5 at 121,350,643 bp
  • A to G, chromosome 6 at 7,559,097 bp
  • T to A, chromosome 6 at 116,698,331 bp
  • A to G, chromosome 8 at 119,546,037 bp
  • A to T, chromosome 8 at 122,908,798 bp
  • A to G, chromosome 9 at 20,300,479 bp
  • T to C, chromosome 9 at 39,550,821 bp
  • C to T, chromosome 9 at 70,718,723 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 97,532,722 bp
  • T to C, chromosome 9 at 99,655,602 bp
  • G to A, chromosome 11 at 34,068,970 bp
  • A to G, chromosome 11 at 34,232,910 bp
  • G to A, chromosome 11 at 58,608,426 bp
  • A to G, chromosome 11 at 69,887,076 bp
  • A to G, chromosome 11 at 119,325,563 bp
  • C to T, chromosome 12 at 13,231,440 bp
  • T to G, chromosome 12 at 102,373,584 bp
  • A to T, chromosome 13 at 37,948,920 bp
  • A to T, chromosome 14 at 59,387,403 bp
  • C to T, chromosome 14 at 75,040,808 bp
  • T to A, chromosome 15 at 28,436,157 bp
  • A to G, chromosome 16 at 20,560,232 bp
  • C to T, chromosome 16 at 59,110,181 bp
  • A to C, chromosome 16 at 63,652,412 bp
  • T to A, chromosome 17 at 20,564,529 bp
  • A to T, chromosome 17 at 71,500,376 bp
  • T to C, chromosome 18 at 34,845,690 bp
  • T to C, chromosome 18 at 36,676,185 bp
  • C to T, chromosome 18 at 53,199,874 bp
  • T to C, chromosome 18 at 62,519,807 bp
  • A to G, chromosome 19 at 9,011,654 bp
  • T to C, chromosome 19 at 10,443,435 bp
  • T to A, chromosome 19 at 33,579,367 bp
  • T to G, chromosome 19 at 39,087,682 bp
  • A to C, chromosome X at 108,664,765 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2911 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.