Strain Name:
C57BL/6J-MtgxR3151Btlr/Mmmh
Stock Number:
040603-MU
Citation ID:
RRID:MMRRC_040603-MU
Other Names:
R3151 (G1), C57BL/6J-MtgxR3151Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, p400, mDomino
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Ssr2
Name: signal sequence receptor, beta
Synonyms: TRAPbeta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66256
Homologene: 2369
Elp1
Name: elongator complex protein 1
Synonyms: C78473, Ikbkap, IKAP, 3110040G09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
F2rl2
Name: coagulation factor II thrombin receptor like 2
Synonyms: PAR-3, PAR3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14064
HGNC: HGNC:3539
Homologene: 36151
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 209456
Homologene: 3959
Rpf1
Name: ribosome production factor 1 homolog
Synonyms: 2210420E24Rik, 2310066N05Rik, Bxdc5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70285
Homologene: 68728
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Ptges2
Name: prostaglandin E synthase 2
Synonyms: GBF-1, GBF1, 0610038H10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 96979
Homologene: 11819
Fndc3b
Name: fibronectin type III domain containing 3B
Synonyms: 1600019O04Rik, fad104
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72007
Homologene: 11244
Cnpy3
Name: canopy FGF signaling regulator 3
Synonyms: 2410050O22Rik, Tnrc5, ERDA5, 1600025D17Rik, CAG4A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72029
Homologene: 4803
Kremen1
Name: kringle containing transmembrane protein 1
Synonyms: Krm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 84035
Homologene: 12935
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Dync1i2
Name: dynein cytoplasmic 1 intermediate chain 2
Synonyms: 3110079H08Rik, Dncic2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13427
HGNC: HGNC:2964
Homologene: 37921
Mtx2
Name: metaxin 2
Synonyms: 1500012G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53375
HGNC: HGNC:7506
Homologene: 4777
Cnih4
Name: cornichon family AMPA receptor auxiliary protein 4
Synonyms: D530030D03Rik, E430023H19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98417
Homologene: 5932
Vac14
Name: Vac14 homolog (S. cerevisiae)
Synonyms: ingls, Trx, D8Wsu151e, Tax1bp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234729
Homologene: 6528
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Or2t6
Name: olfactory receptor family 2 subfamily T member 6
Synonyms: Olfr720, GA_x6K02T2PLTE-6544896-6543946, MOR274-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258387
Homologene: 74036
Rab33b
Name: RAB33B, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19338
Homologene: 9642
Echdc1
Name: enoyl Coenzyme A hydratase domain containing 1
Synonyms: 1700028A24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52665
Homologene: 23106
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: GC-LRR, 4921520L01Rik, Nalp14, Nalp-iota
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, Cav1.1, muscle dysgenesis, DHPR alpha1s, mdg, sj, fmd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 1110004P15Rik, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Del(8)44H, Raw, Svc, Bru, alpha1(IV) collagen, Del(8)Bru44H, Col4a-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR-A, Glur-1, Glur1, 2900051M01Rik, GluA1, Glr1, GluR1, HIPA1, Glr-1, GluRA
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Vmn2r55
Name: vomeronasal 2, receptor 55
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042499
Homologene: 104040
Asap2
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211914
HGNC: HGNC:2721
Homologene: 2888
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Vmn2r121
Name: vomeronasal 2, receptor 121
Synonyms: EG625699
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 100038941
Homologene: 129606
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Fam75d3
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Arl5c
Name: ADP-ribosylation factor-like 5C
Synonyms: Arl12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217151
Homologene: 28456
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: Ido2, Indol1, C230043N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Ssx2ip
Name: SSX family member 2 interacting protein
Synonyms: Adip
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99167
Homologene: 8522
Vmn1r40
Name: vomeronasal 1 receptor 40
Synonyms: V1rb7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113855
Homologene: 113975
Serpinb7
Name: serine (or cysteine) peptidase inhibitor, clade B, member 7
Synonyms: ovalbumin, 4631416M05Rik, megsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116872
Homologene: 68363
Dus3l
Name: dihydrouridine synthase 3 like
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224907
VEGA: 17
Homologene: 6533
Phtf2
Name: putative homeodomain transcription factor 2
Synonyms: 1110054G21Rik, 9530062N20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68770
Homologene: 10713
Fads3
Name: fatty acid desaturase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 60527
VEGA: 19
HGNC: HGNC:3576
Homologene: 11025
Vmn2r51
Name: vomeronasal 2, receptor 51
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042921
Homologene: 113703
Ggt5
Name: gamma-glutamyltransferase 5
Synonyms: GGT-REL, Ggtla1, gamma-glutamyl leukotrienase, GGL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23887
HGNC: HGNC:4260
Homologene: 55802
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Zfp977
Name: zinc finger protein 977
Synonyms: Gm7221
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637776
B230217C12Rik
Name: RIKEN cDNA B230217C12 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68127
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Krtap19-9b
Name: keratin associated protein 19-9B
Synonyms: AY026312, Krtap16-10b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 170939
VEGA: 16
Or12j2
Name: olfactory receptor family 12 subfamily J member 2
Synonyms: Olfr527, GA_x6K02T2PBJ9-42486061-42486978, MOR251-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257939
Homologene: 73958
Sh3bgrl
Name: SH3-binding domain glutamic acid-rich protein like
Synonyms: 1190008F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 56726
Homologene: 2275
Or3a1c
Name: olfactory receptor family 3 subfamily A member 1C
Synonyms: MOR255-4, GA_x6K02T2P1NL-4307199-4308146, Olfr402
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258703
HGNC: HGNC:8282
Homologene: 1915
Magea1
Name: MAGE family member A1
Synonyms: Mage-a1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 17137
Homologene: 23188
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 107,435,351 bp
  • A to T, chromosome 1 at 136,105,794 bp
  • A to G, chromosome 1 at 181,153,727 bp
  • A to G, chromosome 1 at 182,428,960 bp
  • C to T, chromosome 2 at 21,576,960 bp
  • G to A, chromosome 2 at 32,396,476 bp
  • A to G, chromosome 2 at 71,233,716 bp
  • G to A, chromosome 2 at 74,847,290 bp
  • T to A, chromosome 2 at 92,002,033 bp
  • A to G, chromosome 3 at 27,419,503 bp
  • A to T, chromosome 3 at 51,493,648 bp
  • T to C, chromosome 3 at 88,580,016 bp
  • T to C, chromosome 3 at 144,915,511 bp
  • G to A, chromosome 3 at 146,418,383 bp
  • G to A, chromosome 3 at 146,507,635 bp
  • T to C, chromosome 4 at 56,770,985 bp
  • T to A, chromosome 4 at 109,366,222 bp
  • A to G, chromosome 5 at 14,521,678 bp
  • T to C, chromosome 5 at 20,765,804 bp
  • G to T, chromosome 5 at 110,703,569 bp
  • A to G, chromosome 5 at 122,681,266 bp
  • A to T, chromosome 6 at 89,714,566 bp
  • G to A, chromosome 6 at 126,013,317 bp
  • T to C, chromosome 6 at 142,456,333 bp
  • A to T, chromosome 7 at 10,100,041 bp
  • G to T, chromosome 7 at 12,670,707 bp
  • T to A, chromosome 7 at 28,117,240 bp
  • A to T, chromosome 7 at 30,460,240 bp
  • A to C, chromosome 7 at 42,580,446 bp
  • G to A, chromosome 7 at 107,182,552 bp
  • A to T, chromosome 7 at 140,336,330 bp
  • G to A, chromosome 7 at 142,894,075 bp
  • A to G, chromosome 8 at 11,233,933 bp
  • T to A, chromosome 8 at 24,533,760 bp
  • A to G, chromosome 8 at 24,781,631 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • G to T, chromosome 8 at 110,710,309 bp
  • C to T, chromosome 9 at 67,330,547 bp
  • A to G, chromosome 10 at 29,322,364 bp
  • T to C, chromosome 10 at 75,609,242 bp
  • T to C, chromosome 11 at 5,195,012 bp
  • A to G, chromosome 11 at 57,283,562 bp
  • A to T, chromosome 11 at 74,155,640 bp
  • TGTGTCG to TG, chromosome 11 at 97,842,188 bp
  • A to G, chromosome 11 at 97,992,333 bp
  • A to T, chromosome 11 at 119,468,892 bp
  • T to A, chromosome 12 at 21,224,377 bp
  • T to C, chromosome 13 at 59,701,366 bp
  • T to A, chromosome 13 at 93,674,545 bp
  • G to A, chromosome 13 at 95,701,130 bp
  • T to A, chromosome 14 at 14,175,203 bp
  • G to A, chromosome 14 at 79,567,315 bp
  • A to G, chromosome 15 at 27,805,776 bp
  • A to G, chromosome 16 at 21,442,373 bp
  • T to C, chromosome 16 at 88,932,208 bp
  • A to T, chromosome 16 at 90,960,626 bp
  • A to T, chromosome 17 at 46,747,526 bp
  • T to A, chromosome 17 at 56,768,899 bp
  • A to T, chromosome 18 at 21,811,561 bp
  • A to G, chromosome 18 at 78,857,435 bp
  • T to C, chromosome 19 at 9,009,944 bp
  • T to G, chromosome 19 at 10,057,898 bp
  • T to C, chromosome X at 109,160,125 bp
  • C to T, chromosome X at 124,131,152 bp
  • A to T, chromosome X at 155,089,097 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3151 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040603-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.