Strain Name:
C57BL/6J-MtgxR4153Btlr/Mmmh
Stock Number:
040997-MU
Citation ID:
RRID:MMRRC_040997-MU
Other Names:
R4153 (G1), C57BL/6J-MtgxR4153Btlr
Major Collection:

Strain Information

Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20423
Homologene: 30961
Gpd2
Name: glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms: Gdm1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14571
HGNC: HGNC:4456
Homologene: 352
Ebf2
Name: early B cell factor 2
Synonyms: Mmot1, D14Ggc1e, O/E-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Rps6kb1
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: S6K1, p70S6K1, p70/85s6k, 2610318I15Rik, p70s6k
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72508
Homologene: 81703
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Rbpj
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: Igkrsbp, CBF1, Igkjrb, RBP-J kappa, RBPjk, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
HGNC: HGNC:5724
Homologene: 7511
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: Trap150, 9330151F09Rik, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Hip1
Name: huntingtin interacting protein 1
Synonyms: E130315I21Rik, HIP-1, 2610109B09Rik, A930014B11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215114
HGNC: HGNC:4913
Homologene: 68463
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: Coh1, 2310042E16Rik, 1810042B05Rik, C330002D13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, YR-23, D1Bwg0491e, Rw1, Neg, 2610524E03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Pabpc1
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18458
Homologene: 37638
Uty
Name: ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Synonyms: Hydb
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22290
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Pigk
Name: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: 3000001O05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329777
HGNC: HGNC:8965
Homologene: 4002
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Thumpd1
Name: THUMP domain containing 1
Synonyms: 6330575P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233802
Homologene: 5878
Skic2
Name: SKI2 subunit of superkiller complex
Synonyms: Ski2w, 4930534J06Rik, Skiv2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108077
Homologene: 123971
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Pgk-2, Tcp-2, Tcp-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Acat2
Name: acetyl-Coenzyme A acetyltransferase 2
Synonyms: Tcp1-rs1, Tcp-1x
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110460
HGNC: HGNC:94
Homologene: 55855
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Or8g52
Name: olfactory receptor family 8 subfamily G member 52
Synonyms: GA_x6K02T2PVTD-33416730-33417668, Olfr965, MOR171-28
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258165
VEGA: 9
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Gzmn
Name: granzyme N
Synonyms: GrN
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 245839
VEGA: 14
HGNC: HGNC:4709
Homologene: 87221
Gm9457
Name: predicted gene 9457
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 669393
Homologene: 131643
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Adam34l
Name: a disintegrin and metallopeptidase domain 34 like
Synonyms: Gm5346
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384813
Homologene: 78104
Plcl2
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224860
VEGA: 17
HGNC: HGNC:9064
Homologene: 9052
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: Zfp469, EG381742
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: Ugt1a6, UGT1.6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94284
Homologene: 85959
Or52b1
Name: olfactory receptor family 52 subfamily B member 1
Synonyms: Olfr690, MOR31-2, GA_x6K02T2PBJ9-7959171-7958224
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56860
Homologene: 10653
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Gopc
Name: golgi associated PDZ and coiled-coil motif containing
Synonyms: 2210402P09Rik, GOPC1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94221
VEGA: 10
Homologene: 10695
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Hs3st6
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328779
VEGA: 17
Homologene: 84633
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Vmn1r171
Name: vomeronasal 1 receptor 171
Synonyms: V3R7, V1rd7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81012
Homologene: 128341
Or56a3b
Name: olfactory receptor family 56 subfamily A member 3B
Synonyms: GA_x6K02T2PBJ9-7750163-7751110, MOR40-14, Olfr681
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404318
Homologene: 81538
Fastkd3
Name: FAST kinase domains 3
Synonyms: 2310010B21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69577
VEGA: 13
Homologene: 11457
Gzma
Name: granzyme A
Synonyms: Ctla-3, TSP-1, Hanukah factor, H factor, BLT esterase, Ctla3, SE1, TSP1, Hf, serine esterase 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Galnt2l
Name: polypeptide N-acetylgalactosaminyltransferase 2-like
Synonyms: Gm20388
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Erlin1
Name: ER lipid raft associated 1
Synonyms: Keo4, Spfh1, 2810439N09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226144
Homologene: 4716
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 8,583,345 bp
  • T to C, chromosome 1 at 36,808,793 bp
  • A to G, chromosome 1 at 88,138,471 bp
  • A to G, chromosome 2 at 57,355,771 bp
  • A to T, chromosome 2 at 68,668,597 bp
  • T to C, chromosome 3 at 123,672,227 bp
  • G to A, chromosome 3 at 152,740,129 bp
  • A to T, chromosome 4 at 58,089,426 bp
  • T to C, chromosome 4 at 116,315,963 bp
  • A to C, chromosome 4 at 126,173,442 bp
  • G to T, chromosome 4 at 148,051,475 bp
  • A to T, chromosome 5 at 28,457,949 bp
  • T to A, chromosome 5 at 53,649,447 bp
  • C to A, chromosome 5 at 96,776,735 bp
  • T to C, chromosome 5 at 135,412,706 bp
  • T to C, chromosome 5 at 142,765,992 bp
  • A to G, chromosome 6 at 113,143,882 bp
  • A to G, chromosome 7 at 23,632,652 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • A to T, chromosome 7 at 105,122,309 bp
  • T to C, chromosome 7 at 105,329,385 bp
  • C to T, chromosome 7 at 119,720,593 bp
  • T to A, chromosome 8 at 4,813,178 bp
  • T to A, chromosome 8 at 43,626,527 bp
  • T to C, chromosome 8 at 72,681,936 bp
  • A to G, chromosome 8 at 123,304,878 bp
  • A to C, chromosome 9 at 39,720,000 bp
  • T to C, chromosome 10 at 52,349,143 bp
  • A to G, chromosome 10 at 77,268,666 bp
  • G to A, chromosome 11 at 86,549,470 bp
  • A to G, chromosome 11 at 119,409,482 bp
  • C to A, chromosome 13 at 44,910,426 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • T to C, chromosome 13 at 68,590,138 bp
  • T to C, chromosome 13 at 77,193,173 bp
  • T to C, chromosome 13 at 113,096,268 bp
  • G to A, chromosome 14 at 50,837,594 bp
  • T to A, chromosome 14 at 56,167,842 bp
  • T to G, chromosome 14 at 67,235,223 bp
  • T to A, chromosome 15 at 35,792,027 bp
  • G to A, chromosome 15 at 36,605,810 bp
  • G to A, chromosome 16 at 8,696,849 bp
  • T to A, chromosome 17 at 12,952,266 bp
  • AAAACAGGAGTATTGATTGGAAAC to AAAAC, chromosome 17 at 19,523,419 bp
  • A to G, chromosome 17 at 20,267,818 bp
  • T to C, chromosome 17 at 24,758,365 bp
  • G to A, chromosome 17 at 34,847,239 bp
  • A to G, chromosome 17 at 40,208,258 bp
  • A to T, chromosome 17 at 50,606,361 bp
  • T to A, chromosome 19 at 44,067,617 bp
  • A to G, chromosome 19 at 55,281,463 bp
  • A to G, chromosome Y at 1,158,327 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4153 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040997-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.