Strain Name:
C57BL/6J-MtgxR4369Btlr/Mmmh
Stock Number:
041116-MU
Citation ID:
RRID:MMRRC_041116-MU
Other Names:
R4369 (G1), C57BL/6J-MtgxR4369Btlr
Major Collection:

Strain Information

Ing4
Name: inhibitor of growth family, member 4
Synonyms: D6Xrf92, p29ING4, D6Wsu147e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28019
Homologene: 22952
Nmral1
Name: NmrA-like family domain containing 1
Synonyms: 1110025F24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67824
Homologene: 41388
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Dhx38
Name: DEAH-box helicase 38
Synonyms: 5730550P09Rik, Prp16, Ddx38
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Ebag9
Name: estrogen receptor-binding fragment-associated gene 9
Synonyms: Rcas1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 55960
VEGA: 15
HGNC: HGNC:3123
Homologene: 3107
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: C130058G22Rik, CSB, CS group B correcting gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Rnf121
Name: ring finger protein 121
Synonyms: 4930544L10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75212
Homologene: 10132
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Lhx4
Name: LIM homeobox protein 4
Synonyms: Gsh4, Gsh-4, A330062J17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16872
Homologene: 56497
Zswim6
Name: zinc finger SWIM-type containing 6
Synonyms: 2900036G02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67263
VEGA: 13
Homologene: 83517
Fbxl5
Name: F-box and leucine-rich repeat protein 5
Synonyms: Fbl4, Fir4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242960
Homologene: 8129
Dpep2
Name: dipeptidase 2
Synonyms: F630103D06Rik, MBD-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319446
Homologene: 49703
Amph
Name: amphiphysin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218038
HGNC: HGNC:471
Homologene: 121585
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Ier3ip1
Name: immediate early response 3 interacting protein 1
Synonyms: 1110057H19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66191
Homologene: 41106
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14972
Homologene: 128352
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: b2b1554Clo, A2mr, CD91
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Dusp19
Name: dual specificity phosphatase 19
Synonyms: 5930436K22Rik, SKRP1, C79103, TS-DSP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68082
Homologene: 41565
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
Pglyrp3
Name: peptidoglycan recognition protein 3
Synonyms: LOC242100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242100
Homologene: 71559
Dcaf11
Name: DDB1 and CUL4 associated factor 11
Synonyms: D14Ucla1, GLO14, 0710008A13Rik, Wdr23
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 28199
Homologene: 11886
AU018091
Name: expressed sequence AU018091
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245128
Homologene: 106376
Golgb1
Name: golgin B1
Synonyms: 6330407A06Rik, Giantin, Gm6840, C130074L01Rik, F730017E11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: 1810018P12Rik, Sk2, Atpsk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Trgv4
Name: T cell receptor gamma, variable 4
Synonyms: Tcrg-V4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21638
A730018C14Rik
Name: RIKEN cDNA A730018C14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100504733
VEGA: 12
Rnf122
Name: ring finger protein 122
Synonyms: 1110063C11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68867
Homologene: 11717
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Arg2
Name: arginase type II
Synonyms: AII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11847
HGNC: HGNC:664
Homologene: 906
Or2a25
Name: olfactory receptor family 2 subfamily A member 25
Synonyms: MOR261-1, Olfr447, GA_x6K02T2P3E9-4647978-4647046
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258990
Homologene: 17457
Apoh
Name: apolipoprotein H
Synonyms: beta-2-glycoprotein 1, beta-2-GPI, B2GPI
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11818
HGNC: HGNC:616
Homologene: 26
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Map7d1
Name: MAP7 domain containing 1
Synonyms: Mtap7d1, Rprc1, Parcc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 245877
Homologene: 17009
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, Dsbc1, G1-419-29, Rcr1, repro7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Gm20547
Name: predicted gene 20547
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
5730596B20Rik
Name: RIKEN cDNA 5730596B20 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77580
VEGA: 6
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: MOR204-7, GA_x6K02T2PBJ9-10951546-10952496, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: Mrp1, Abcc1a, Mdrap, MRP, Abcc1b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Galnt15
Name: polypeptide N-acetylgalactosaminyltransferase 15
Synonyms: 4631401E18Rik, Galntl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78754
Homologene: 14286
Epha1
Name: Eph receptor A1
Synonyms: Esk, 5730453L17Rik, Eph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Ffar1
Name: free fatty acid receptor 1
Synonyms: Gpr40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233081
HGNC: HGNC:4498
Homologene: 3876
Fbxw5
Name: F-box and WD-40 domain protein 5
Synonyms: Fbw5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30839
Homologene: 8496
Akr1c19
Name: aldo-keto reductase family 1, member C19
Synonyms: 1810010N06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432720
HGNC: HGNC:387
Homologene: 134145
Cyp4f14
Name: cytochrome P450, family 4, subfamily f, polypeptide 14
Synonyms: 1300014O15Rik, leukotriene B4 omega hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64385
VEGA: 17
Homologene: 81872
Speer3
Name: spermatogenesis associated glutamate (E)-rich protein 3
Synonyms: 4933405P08Rik, SPEER-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71026
Homologene: 69402
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12041
Homologene: 37642
4933431E20Rik
Name: RIKEN cDNA 4933431E20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329735
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Gm6625
Name: predicted gene 6625
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 625801
Gm10045
Name: predicted pseudogene 10045
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100043348
Homologene: 138779
Pcdha10
Name: protocadherin alpha 10
Synonyms: Pcdha14, Cnr8, Cnr3, Crnr8, Crnr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12943
VEGA: 18
HGNC: HGNC:8666
Homologene: 135720
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 155,704,814 bp
  • C to T, chromosome 2 at 25,504,761 bp
  • C to T, chromosome 2 at 76,764,001 bp
  • A to T, chromosome 2 at 80,631,051 bp
  • T to C, chromosome 3 at 92,028,079 bp
  • C to T, chromosome 3 at 100,948,199 bp
  • T to C, chromosome 3 at 107,891,014 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • A to T, chromosome 4 at 126,235,073 bp
  • A to G, chromosome 4 at 156,237,396 bp
  • C to G, chromosome 5 at 13,796,380 bp
  • C to T, chromosome 5 at 43,760,740 bp
  • C to T, chromosome 6 at 12,468,908 bp
  • T to C, chromosome 6 at 42,365,457 bp
  • T to A, chromosome 6 at 42,912,277 bp
  • A to T, chromosome 6 at 52,179,062 bp
  • T to C, chromosome 6 at 125,047,089 bp
  • A to T, chromosome 7 at 3,157,975 bp
  • A to G, chromosome 7 at 30,860,608 bp
  • T to C, chromosome 7 at 102,024,106 bp
  • C to T, chromosome 7 at 108,621,889 bp
  • C to T, chromosome 7 at 127,906,419 bp
  • T to C, chromosome 7 at 144,179,781 bp
  • T to A, chromosome 8 at 31,112,149 bp
  • T to C, chromosome 8 at 89,147,031 bp
  • T to A, chromosome 8 at 104,217,110 bp
  • T to G, chromosome 8 at 105,985,075 bp
  • C to T, chromosome 8 at 109,553,131 bp
  • A to T, chromosome 10 at 79,396,080 bp
  • T to C, chromosome 10 at 127,550,286 bp
  • C to T, chromosome 11 at 74,932,443 bp
  • T to C, chromosome 11 at 76,797,711 bp
  • T to C, chromosome 11 at 108,397,379 bp
  • T to C, chromosome 12 at 79,149,972 bp
  • T to C, chromosome 12 at 112,415,614 bp
  • A to T, chromosome 13 at 4,233,780 bp
  • T to A, chromosome 13 at 19,137,700 bp
  • T to C, chromosome 13 at 19,185,397 bp
  • A to G, chromosome 13 at 107,726,694 bp
  • C to T, chromosome 14 at 7,942,216 bp
  • T to C, chromosome 14 at 32,029,539 bp
  • A to G, chromosome 14 at 32,517,207 bp
  • G to T, chromosome 14 at 55,565,708 bp
  • C to T, chromosome 15 at 44,505,553 bp
  • T to C, chromosome 15 at 44,628,469 bp
  • T to C, chromosome 15 at 73,540,809 bp
  • T to C, chromosome 16 at 4,714,530 bp
  • T to G, chromosome 16 at 14,460,993 bp
  • T to C, chromosome 16 at 33,224,648 bp
  • A to G, chromosome 16 at 36,916,907 bp
  • A to G, chromosome 17 at 3,413,967 bp
  • T to C, chromosome 17 at 15,544,446 bp
  • C to T, chromosome 17 at 28,836,620 bp
  • G to A, chromosome 17 at 29,308,576 bp
  • T to C, chromosome 17 at 32,909,258 bp
  • C to T, chromosome 17 at 33,999,816 bp
  • T to C, chromosome 17 at 34,860,314 bp
  • T to C, chromosome 18 at 37,006,743 bp
  • G to A, chromosome 18 at 76,940,574 bp
  • A to G, chromosome 19 at 32,641,391 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4369 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041116-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.