Strain Name:
C57BL/6J-MtgxR5658Btlr/Mmmh
Stock Number:
043172-MU
Citation ID:
RRID:MMRRC_043172-MU
Other Names:
R5658 (G1), C57BL/6J-MtgxR5658Btlr
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: PTPzeta, DSD-1-PG, phosphacan, RPTPz, Ptprz, Ptpz, Rptpbeta, PTPbeta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Srisnf2l, G630026H09Rik, Arip4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Lactb2
Name: lactamase, beta 2
Synonyms: Cgi-83, E430032H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212442
Homologene: 9349
Faf2
Name: Fas associated factor family member 2
Synonyms: 2210404D11Rik, Ubxd8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76577
Homologene: 8753
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 1110031N14Rik, 2810429C13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Slc38a10
Name: solute carrier family 38, member 10
Synonyms: 1810073N04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72055
Homologene: 41556
Mlh1
Name: mutL homolog 1
Synonyms: colon cancer, nonpolyposis type 2, 1110035C23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17350
HGNC: HGNC:7127
Homologene: 208
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Bccip
Name: BRCA2 and CDKN1A interacting protein
Synonyms: TOK-1, 1110013J05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66165
HGNC: HGNC:978
Homologene: 41629
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, Itpr-3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, skrr, calcium release channel isoform 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Pmpcb
Name: peptidase (mitochondrial processing) beta
Synonyms: MPPP52, MPP11, 3110004O18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73078
HGNC: HGNC:9119
Homologene: 3160
Kcnq1
Name: potassium voltage-gated channel, subfamily Q, member 1
Synonyms: KVLQT1, Kcna9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16535
HGNC: HGNC:6294
Homologene: 85014
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Myef2l
Name: myelin expression factor 2 like
Synonyms: Gm9833
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100041480
Kng2
Name: kininogen 2
Synonyms: Kininogen-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385643
HGNC: HGNC:6383
Homologene: 88343
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Ormdl1
Name: ORM1-like 1 (S. cerevisiae)
Synonyms: C730042F17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227102
Homologene: 41135
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 1300010F03Rik, 4932416F07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Nebl
Name: nebulette
Synonyms: D830029A09Rik, A630080F05Rik, 1200007O21Rik, Lnebl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Sntb1
Name: syntrophin, basic 1
Synonyms: 59-1 DAP, beta1-Syntrophin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20649
Homologene: 9618
Tnfaip6
Name: tumor necrosis factor alpha induced protein 6
Synonyms: TSG-6, Tsg6, Tnfip6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21930
Homologene: 5162
Gm6104
Name: predicted gene 6104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 619829
Gm7535
Name: predicted gene 7535
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665187
VEGA: 17
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Itih3
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Itih-3, Intin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16426
HGNC: HGNC:6168
Homologene: 1669
Gm15964
Name: predicted gene 15964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Mrgprh
Name: MAS-related GPR, member H
Synonyms: MrgH, Gpr90
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 80978
VEGA: 17
Homologene: 12758
4930522H14Rik
Name: RIKEN cDNA 4930522H14 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67646
Homologene: 49856
Kcnh3
Name: potassium voltage-gated channel, subfamily H (eag-related), member 3
Synonyms: ether a go-go like, Elk2, C030044P22Rik, Melk2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16512
VEGA: 15
HGNC: HGNC:6252
Homologene: 32150
Kbtbd4
Name: kelch repeat and BTB (POZ) domain containing 4
Synonyms: 2510026C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67136
Homologene: 32320
Sh3bp2
Name: SH3-domain binding protein 2
Synonyms: 3BP2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24055
Homologene: 2276
Ldc1
Name: leucine decarboxylase 1
Synonyms: Gm853, LOC332942
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 332942
Homologene: 128653
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Art2b
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6, Rt-6, ART2.2, Rt6-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11872
Homologene: 113756
Try5
Name: trypsin 5
Synonyms: 1810049H19Rik, Tc
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103964
Homologene: 106639
Maf1
Name: MAF1 homolog, negative regulator of RNA polymerase III
Synonyms: Maf1, 1110068E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68877
Homologene: 49867
Sowahc
Name: sosondowah ankyrin repeat domain family member C
Synonyms: C820004L04Rik, Ankrd57
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268301
Homologene: 49723
Tmem181b-ps
Name: transmembrane protein 181B, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 547127
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,880,367 bp
  • T to A, chromosome 1 at 13,627,418 bp
  • T to C, chromosome 1 at 53,308,934 bp
  • G to C, chromosome 1 at 133,272,307 bp
  • C to A, chromosome 1 at 164,192,338 bp
  • A to G, chromosome 2 at 17,348,852 bp
  • A to T, chromosome 2 at 52,051,035 bp
  • T to A, chromosome 2 at 90,906,079 bp
  • A to T, chromosome 2 at 126,397,715 bp
  • A to T, chromosome 2 at 180,208,276 bp
  • C to T, chromosome 3 at 10,088,777 bp
  • A to G, chromosome 4 at 109,505,447 bp
  • A to G, chromosome 4 at 130,220,441 bp
  • A to G, chromosome 5 at 21,739,001 bp
  • T to A, chromosome 5 at 34,556,947 bp
  • G to A, chromosome 6 at 23,016,189 bp
  • T to C, chromosome 6 at 41,312,427 bp
  • A to T, chromosome 7 at 29,091,089 bp
  • A to G, chromosome 7 at 101,580,362 bp
  • A to G, chromosome 7 at 133,717,620 bp
  • G to A, chromosome 7 at 143,363,695 bp
  • A to G, chromosome 8 at 111,890,790 bp
  • G to T, chromosome 9 at 44,509,169 bp
  • A to G, chromosome 9 at 103,336,195 bp
  • ACCTCCTCCTCCTCCTCCTCCTCCTC to ACCTCCTCCTCCTCCTCCTCCTC, chromosome 9 at 106,753,992 bp
  • A to G, chromosome 9 at 107,522,228 bp
  • A to G, chromosome 9 at 111,247,380 bp
  • G to A, chromosome 10 at 59,223,227 bp
  • C to T, chromosome 11 at 20,241,885 bp
  • A to G, chromosome 11 at 100,190,767 bp
  • C to T, chromosome 11 at 120,105,392 bp
  • A to G, chromosome 12 at 30,055,138 bp
  • T to C, chromosome 13 at 54,641,534 bp
  • G to T, chromosome 13 at 68,568,915 bp
  • T to C, chromosome 14 at 30,921,418 bp
  • T to C, chromosome 14 at 78,982,398 bp
  • C to T, chromosome 15 at 55,792,076 bp
  • T to C, chromosome 15 at 76,353,220 bp
  • C to T, chromosome 15 at 99,242,076 bp
  • T to C, chromosome 16 at 22,997,020 bp
  • C to T, chromosome 16 at 91,621,775 bp
  • A to T, chromosome 17 at 6,450,466 bp
  • A to T, chromosome 17 at 12,877,759 bp
  • T to A, chromosome 17 at 17,911,320 bp
  • T to C, chromosome 17 at 27,107,878 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5658 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043172-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.