Strain Name:
C57BL/6J-MtgxR5810Btlr/Mmmh
Stock Number:
043395-MU
Citation ID:
RRID:MMRRC_043395-MU
Other Names:
R5810 (G1)
Major Collection:

Strain Information

Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Dst
Name: dystonin
Synonyms: Macf2, A830042E19Rik, Bpag1, Bpag, bullous pemphigoid antigen 1, nmf203, athetoid, nmf339, BPAG1, BPAG1-n, 2310001O04Rik, bullous pemphigoid antigen 1, ah
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Tfpi
Name: tissue factor pathway inhibitor
Synonyms: A630013F22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21788
Homologene: 4579
Stx1a
Name: syntaxin 1A (brain)
Synonyms: HPC-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20907
Homologene: 37941
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 9030227G01Rik, 2510002A14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Tara, Mus EST 478828, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Abca1
Name: ATP-binding cassette, sub-family A member 1
Synonyms: ABC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Mtg1
Name: mitochondrial ribosome-associated GTPase 1
Synonyms: Gtpbp7, LOC212508
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212508
Homologene: 44527
Il15ra
Name: interleukin 15 receptor, alpha chain
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16169
HGNC: HGNC:5978
Homologene: 1650
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100273
Homologene: 69380
Tbc1d13
Name: TBC1 domain family, member 13
Synonyms: 2600014A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70296
Homologene: 10068
Ywhaz
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Synonyms: 14-3-3 zeta, 1110013I11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22631
Homologene: 56528
Fchsd1
Name: FCH and double SH3 domains 1
Synonyms: A030002D08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319262
Homologene: 14127
Il17re
Name: interleukin 17 receptor E
Synonyms: Il25r
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57890
Homologene: 17109
Snrpd2
Name: small nuclear ribonucleoprotein D2
Synonyms: SMD2, 1810009A06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107686
Homologene: 3381
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Wcrf180, Acf1, Gtl5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Actr3
Name: ARP3 actin-related protein 3
Synonyms: Arp3, 1200003A09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74117
HGNC: HGNC:170
Homologene: 68483
Cnnm3
Name: cyclin M3
Synonyms: Acdp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94218
HGNC: HGNC:104
Homologene: 23029
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930543C13Rik, D330038K10Rik, 4930516E05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: LOC384311, mSSH-1L
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Ceacam18
Name: CEA cell adhesion molecule 18
Synonyms: 2010110O04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72431
Homologene: 48111
Liph
Name: lipase, member H
Synonyms: PLA1B, mPA-PLA1, D16Wsu119e, C130037N08Rik, LPDLR, Lpdlr
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Hoxa7
Name: homeobox A7
Synonyms: Hox-1.1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15404
HGNC: HGNC:5108
Homologene: 56001
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Vmn2r102
Name: vomeronasal 2, receptor 102
Synonyms: EG224572
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224572
Homologene: 115024
Gpatch1
Name: G patch domain containing 1
Synonyms: Gpatc1, 1300003A17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67471
Homologene: 41217
Vmn1r194
Name: vomeronasal 1 receptor 194
Synonyms: Gm11294
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 626299
Homologene: 110880
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: Adlican2, CMF608, 6530405F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Sspo
Name: SCO-spondin
Synonyms: Scospondin, C79529
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: brachyphalangy, Bph
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20684
Homologene: 86761
Ninl
Name: ninein-like
Synonyms: 4930519N13Rik, LOC381388, LOC381387
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Lgals12
Name: lectin, galactose binding, soluble 12
Synonyms: GRIP1, galectin-related inhibitor of proliferation, galectin-12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56072
Homologene: 10462
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Or1e22
Name: olfactory receptor family 1 subfamily E member 22
Synonyms: Olfr381, GA_x6K02T2P1NL-3646409-3645474, MOR135-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259024
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Npm3
Name: nucleoplasmin 3
Synonyms: Nub1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18150
HGNC: HGNC:7931
Homologene: 5083
Slc22a16
Name: solute carrier family 22 (organic cation transporter), member 16
Synonyms: OKB1, FLIPT2, CT2, OCT6, 4921504E14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70840
Homologene: 41957
Car13
Name: carbonic anhydrase 13
Synonyms: 2310075C21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71934
Homologene: 75207
Dyrk2
Name: dual-specificity tyrosine phosphorylation regulated kinase 2
Synonyms: 1810038L18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69181
VEGA: 10
HGNC: HGNC:3093
Homologene: 48437
Bpifa5
Name: BPI fold containing family A, member 5
Synonyms: 2310021H06Rik, 2310074B19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67135
Homologene: 12087
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: Nope, 9330155G14Rik, WI-16786, WI-18508
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56741
VEGA: 9
Homologene: 10570
Spg7
Name: SPG7, paraplegin matrix AAA peptidase subunit
Synonyms: spastic paraplegia 7 homolog (human), Cmar, paraplegin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234847
Homologene: 31133
Esd
Name: esterase D/formylglutathione hydrolase
Synonyms: Es-10, Es10, Esd
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13885
HGNC: HGNC:3465
Homologene: 55623
Tymp
Name: thymidine phosphorylase
Synonyms: PDECGF, Pdgfec, 2900072D10Rik, gliostatin, Ecgf1, PD-ECGF
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72962
VEGA: 15
HGNC: HGNC:3148
Homologene: 1474
Tpm2
Name: tropomyosin 2, beta
Synonyms: Trop-2, Tpm-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22004
Homologene: 134309
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, mOat1, Oat1, Orctl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Cyp4f14
Name: cytochrome P450, family 4, subfamily f, polypeptide 14
Synonyms: 1300014O15Rik, leukotriene B4 omega hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64385
VEGA: 17
Homologene: 81872
Zfp322a
Name: zinc finger protein 322A
Synonyms: 9630054P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218100
Homologene: 23460
Pgam2
Name: phosphoglycerate mutase 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56012
HGNC: HGNC:8889
Homologene: 56228
Fam53b
Name: family with sequence similarity 53, member B
Synonyms: A930008G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77938
Homologene: 8776
Larp7-ps
Name: La ribonucleoprotein 7, transcriptional regulator, pseudogene
Synonyms: Gm12666
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68280
Procr
Name: protein C receptor, endothelial
Synonyms: EPCR, Ccca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19124
HGNC: HGNC:9452
Homologene: 4670
Krtap19-2
Name: keratin associated protein 19-2
Synonyms: Krtap16-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170651
VEGA: 16
6330408A02Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 7
Gm28308
Name: predicted gene 28308
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,200,673 bp
  • G to A, chromosome 1 at 34,183,040 bp
  • A to G, chromosome 1 at 36,525,199 bp
  • G to A, chromosome 1 at 85,665,285 bp
  • A to T, chromosome 1 at 97,075,873 bp
  • A to G, chromosome 1 at 125,416,379 bp
  • A to G, chromosome 2 at 11,733,252 bp
  • C to A, chromosome 2 at 30,142,368 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA, chromosome 2 at 84,434,424 bp
  • T to C, chromosome 2 at 150,950,168 bp
  • G to A, chromosome 2 at 154,163,718 bp
  • A to G, chromosome 2 at 155,751,407 bp
  • A to T, chromosome 2 at 156,499,655 bp
  • A to C, chromosome 3 at 14,641,768 bp
  • G to A, chromosome 3 at 59,319,071 bp
  • A to T, chromosome 3 at 64,117,394 bp
  • T to C, chromosome 4 at 43,518,968 bp
  • A to G, chromosome 4 at 53,079,631 bp
  • A to T, chromosome 4 at 92,191,583 bp
  • A to G, chromosome 4 at 109,086,374 bp
  • A to T, chromosome 5 at 73,090,755 bp
  • A to G, chromosome 5 at 112,834,450 bp
  • T to C, chromosome 5 at 113,946,566 bp
  • G to T, chromosome 5 at 135,049,078 bp
  • C to T, chromosome 6 at 48,483,898 bp
  • C to A, chromosome 6 at 52,213,216 bp
  • T to C, chromosome 6 at 52,216,024 bp
  • C to T, chromosome 6 at 113,469,596 bp
  • A to T, chromosome 7 at 13,260,735 bp
  • G to T, chromosome 7 at 19,152,522 bp
  • G to A, chromosome 7 at 35,295,371 bp
  • A to T, chromosome 7 at 43,636,958 bp
  • T to A, chromosome 7 at 120,435,932 bp
  • T to A, chromosome 7 at 132,760,164 bp
  • T to A, chromosome 7 at 140,145,985 bp
  • C to T, chromosome 8 at 62,012,388 bp
  • G to A, chromosome 8 at 123,094,569 bp
  • A to G, chromosome 9 at 65,128,695 bp
  • C to T, chromosome 9 at 107,929,221 bp
  • C to T, chromosome 10 at 40,595,318 bp
  • G to T, chromosome 10 at 118,860,340 bp
  • T to C, chromosome 11 at 5,803,417 bp
  • G to T, chromosome 11 at 73,486,095 bp
  • G to A, chromosome 12 at 54,927,715 bp
  • T to C, chromosome 13 at 15,644,309 bp
  • T to A, chromosome 13 at 22,244,427 bp
  • A to C, chromosome 13 at 23,357,409 bp
  • A to G, chromosome 14 at 24,146,254 bp
  • G to T, chromosome 14 at 45,602,707 bp
  • A to G, chromosome 14 at 74,745,611 bp
  • T to C, chromosome 15 at 36,775,266 bp
  • T to C, chromosome 15 at 78,968,267 bp
  • T to A, chromosome 15 at 89,374,331 bp
  • A to T, chromosome 16 at 21,968,110 bp
  • T to C, chromosome 16 at 88,874,236 bp
  • T to C, chromosome 17 at 19,677,542 bp
  • T to A, chromosome 17 at 32,906,098 bp
  • A to C, chromosome 17 at 74,670,374 bp
  • C to T, chromosome 18 at 37,959,873 bp
  • T to C, chromosome 19 at 7,606,720 bp
  • A to G, chromosome 19 at 8,623,858 bp
  • T to C, chromosome 19 at 16,666,324 bp
  • A to G, chromosome 19 at 45,748,205 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5810 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043395-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.