Strain Name:
C57BL/6J-MtgxR6576Btlr/Mmmh
Stock Number:
044700-MU
Citation ID:
RRID:MMRRC_044700-MU
Other Names:
R6576 (G1)
Major Collection:

Strain Information

Lasp1
Name: LIM and SH3 protein 1
Synonyms: Def-4, SH3P6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16796
HGNC: HGNC:6513
Homologene: 4480
Gtf2i
Name: general transcription factor II I
Synonyms: BAP-135, 6030441I21Rik, TFII-I
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Mrpl20
Name: mitochondrial ribosomal protein L20
Synonyms: 4930425I20Rik, 2610008D01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66448
Homologene: 9941
Pik3c3
Name: phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms: 5330434F23Rik, Vps34
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225326
HGNC: HGNC:8974
Homologene: 1986
Aff4
Name: AF4/FMR2 family, member 4
Synonyms: Alf4, Laf4l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93736
Homologene: 8683
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: Duplin, 5830451P18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Xpo5
Name: exportin 5
Synonyms: 2410004H11Rik, 2700038C24Rik, Exp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72322
VEGA: 17
Homologene: 69316
Lmbr1
Name: limb region 1
Synonyms: C79130, 1110048D14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56873
Homologene: 49706
Snx29
Name: sorting nexin 29
Synonyms: Gm11170, LOC385605, 4933437K13Rik, LOC381035, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Shld2
Name: shieldin complex subunit 2
Synonyms: Fam35a, 3110001K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75698
VEGA: 14
Homologene: 56840
Rnf167
Name: ring finger protein 167
Synonyms: 5730408C10Rik, 0610010G05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70510
Homologene: 41046
Tln1
Name: talin 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21894
Homologene: 21267
Apba3
Name: amyloid beta precursor protein binding family A member 3
Synonyms: Mint-3, neuronal munc18-1-interacting protein 3, neuron-specific X11L2 protein, X11gamma, Mint 3, lin-10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57267
VEGA: 10
HGNC: HGNC:580
Homologene: 3591
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Eddm13
Name: epididymal protein 13
Synonyms: Epp13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 627821
Id1
Name: inhibitor of DNA binding 1, HLH protein
Synonyms: Idb1, D2Wsu140e, bHLHb24
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15901
HGNC: HGNC:5360
Homologene: 1631
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: tumstatin, alpha3(IV)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Sox6
Name: SRY (sex determining region Y)-box 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20679
Homologene: 22631
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Fat3
Name: FAT atypical cadherin 3
Synonyms: D430038H04Rik, LOC234973, LOC382129, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: Ccdc135, SRG-L, LOC330830
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Mrgprx2
Name: MAS-related GPR, member X2
Synonyms: MrgB10, Mrgprb10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243978
Homologene: 24986
Wdr64
Name: WD repeat domain 64
Synonyms: 4930511H01Rik, 4930415O10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Cep162
Name: centrosomal protein 162
Synonyms: 4922501C03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382090
Homologene: 8930
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, D4Bwg0615e, CARDIAK, RIP2, RICK, CARD3, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Rilp
Name: Rab interacting lysosomal protein
Synonyms: LOC333615
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 280408
Homologene: 19596
Asap2
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211914
HGNC: HGNC:2721
Homologene: 2888
Klc3
Name: kinesin light chain 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232943
Homologene: 14899
4933430I17Rik
Name: RIKEN cDNA 4933430I17 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214106
Homologene: 51897
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
HGNC: HGNC:1863
Homologene: 117484
Cldn15
Name: claudin 15
Synonyms: 2210009B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 60363
HGNC: HGNC:2036
Homologene: 8646
Vmn2r23
Name: vomeronasal 2, receptor 23
Synonyms: EG435916
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435916
Homologene: 135826
Med11
Name: mediator complex subunit 11
Synonyms: 1110030J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66172
Homologene: 32630
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226565
Homologene: 68130
Dnaaf3
Name: dynein, axonemal assembly factor 3
Synonyms: b2b1739Clo, 6030429G01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436022
Homologene: 16205
Lrrc75a
Name: leucine rich repeat containing 75A
Synonyms: BC046404, Fam211a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192976
Homologene: 65996
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 82,708,574 bp
  • A to G, chromosome 1 at 162,922,695 bp
  • G to T, chromosome 1 at 175,805,928 bp
  • T to C, chromosome 2 at 152,736,663 bp
  • T to C, chromosome 3 at 38,979,690 bp
  • T to A, chromosome 4 at 11,601,577 bp
  • A to T, chromosome 4 at 16,131,558 bp
  • A to T, chromosome 4 at 43,555,419 bp
  • A to T, chromosome 4 at 62,532,605 bp
  • A to G, chromosome 4 at 155,806,914 bp
  • A to T, chromosome 5 at 29,291,310 bp
  • T to C, chromosome 5 at 134,263,702 bp
  • A to T, chromosome 5 at 136,974,616 bp
  • A to G, chromosome 6 at 123,733,273 bp
  • A to G, chromosome 7 at 4,523,380 bp
  • G to A, chromosome 7 at 6,277,542 bp
  • G to T, chromosome 7 at 19,397,980 bp
  • A to T, chromosome 7 at 48,482,632 bp
  • T to A, chromosome 7 at 115,701,702 bp
  • T to A, chromosome 8 at 71,653,478 bp
  • T to A, chromosome 8 at 93,056,919 bp
  • A to T, chromosome 8 at 95,075,258 bp
  • G to A, chromosome 9 at 16,377,210 bp
  • T to C, chromosome 9 at 51,849,278 bp
  • A to G, chromosome 9 at 87,217,145 bp
  • A to G, chromosome 10 at 81,273,091 bp
  • G to A, chromosome 10 at 130,478,785 bp
  • C to A, chromosome 11 at 53,400,441 bp
  • G to A, chromosome 11 at 62,605,869 bp
  • G to T, chromosome 11 at 70,453,170 bp
  • A to C, chromosome 11 at 70,649,762 bp
  • A to G, chromosome 11 at 75,512,392 bp
  • C to T, chromosome 11 at 97,833,576 bp
  • A to G, chromosome 12 at 21,244,703 bp
  • T to C, chromosome 14 at 20,721,874 bp
  • T to C, chromosome 14 at 34,268,242 bp
  • T to C, chromosome 14 at 52,216,076 bp
  • T to C, chromosome 15 at 66,025,178 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • T to C, chromosome 16 at 11,715,056 bp
  • T to A, chromosome 17 at 46,240,808 bp
  • A to G, chromosome 18 at 30,342,741 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6576 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044700-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.