Strain Name:
C57BL/6J-MtgxR6822Btlr/Mmmh
Stock Number:
044934-MU
Citation ID:
RRID:MMRRC_044934-MU
Other Names:
R6822 (G1)
Major Collection:

Strain Information

Pax6
Name: paired box 6
Synonyms: Gsfaey11, Dickie's small eye, AEY11, 1500038E17Rik, Pax-6, Dey
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18508
HGNC: HGNC:8620
Homologene: 1212
Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: Semaphorin K1, 2900057C09Rik, CDw108, Semal
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
Spry2
Name: sprouty RTK signaling antagonist 2
Synonyms: sprouty2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 24064
VEGA: 14
Homologene: 4267
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dst
Name: dystonin
Synonyms: Macf2, A830042E19Rik, Bpag1, Bpag, bullous pemphigoid antigen 1, nmf203, athetoid, nmf339, BPAG1, BPAG1-n, 2310001O04Rik, bullous pemphigoid antigen 1, ah
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Rexo4
Name: REX4, 3'-5' exonuclease
Synonyms: XPMC2H, Rex4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227656
Homologene: 133948
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: Wdr9, D530019K20Rik, G1-403-16, 5330419I02Rik, repro5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Smpd4
Name: sphingomyelin phosphodiesterase 4
Synonyms: neutral membrane (neutral sphingomyelinase-3), 4122402O22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77626
Homologene: 9813
Fam193b
Name: family with sequence similarity 193, member B
Synonyms: IRIZIO
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212483
VEGA: 13
Homologene: 130095
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Epm2aip1
Name: EPM2A interacting protein 1
Synonyms: A930003G21Rik, EPM2A (laforin) interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77781
Homologene: 8875
Ptger1
Name: prostaglandin E receptor 1 (subtype EP1)
Synonyms: EP1, 42kDa, Ptgerep1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19216
HGNC: HGNC:9593
Homologene: 738
Adam11
Name: a disintegrin and metallopeptidase domain 11
Synonyms: Mdc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11488
HGNC: HGNC:189
Homologene: 7614
Tubb4a
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Dpep2
Name: dipeptidase 2
Synonyms: F630103D06Rik, MBD-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319446
Homologene: 49703
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: Dasm1, NRT1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Nucb1
Name: nucleobindin 1
Synonyms: MTEST82, Calnuc, B230337F23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18220
HGNC: HGNC:8043
Homologene: 4507
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Rpl10l
Name: ribosomal protein L10-like
Synonyms: EG238217
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238217
Homologene: 68830
Smpd3
Name: sphingomyelin phosphodiesterase 3, neutral
Synonyms: fro, neutral sphingomyelinase II, nSMase2, Nsm2, 4631433G07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58994
Homologene: 10260
Dclk3
Name: doublecortin-like kinase 3
Synonyms: Click-I, -II related, Dcamkl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245038
Homologene: 70580
Sohlh2
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74434
Homologene: 9864
Entpd3
Name: ectonucleoside triphosphate diphosphohydrolase 3
Synonyms: NTPDase-3, Cd39l3, HB6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215446
HGNC: HGNC:3365
Homologene: 68171
Nlgn1
Name: neuroligin 1
Synonyms: 6330415N05Rik, NL1, Nlg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192167
Homologene: 56690
Tbx19
Name: T-box 19
Synonyms: D1Ertd754e, Tpit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 83993
Homologene: 3779
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210510
Homologene: 19364
Sos2
Name: SOS Ras/Rho guanine nucleotide exchange factor 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20663
Homologene: 38253
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: Ankrd3, PKK, RIP4, DIk, ANKK2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: 5730414M22Rik, Slo, MaxiK, BKCa, BK channel alpha subunit, mSlo1, Slo1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Grik5
Name: glutamate receptor, ionotropic, kainate 5 (gamma 2)
Synonyms: GluRgamma2, KA2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14809
HGNC: HGNC:4583
Homologene: 1578
Map3k13
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71751
VEGA: 16
HGNC: HGNC:6852
Homologene: 37958
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: Mll4, C430014K11Rik, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Tinag
Name: tubulointerstitial nephritis antigen
Synonyms: TIN-ag
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26944
Homologene: 8082
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Fam50b
Name: family with sequence similarity 50, member B
Synonyms: D0H6S2654E, X5L, XAP-5-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108161
VEGA: 13
Homologene: 101669
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
Kcnmb1
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 1
Synonyms: BK channel beta subunit, BKbeta1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16533
HGNC: HGNC:6285
Homologene: 3054
AI987944
Name: expressed sequence AI987944
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233168
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Cct8l1
Name: chaperonin containing TCP1 subunit 8-like 1
Synonyms: Gm443, LOC242891
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242891
Homologene: 40943
H2-Aa
Name: histocompatibility 2, class II antigen A, alpha
Synonyms: I-Aalpha, Ia-1, Aalpha, H-2Aa, A alpha, Ia1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14960
Homologene: 123820
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,275,674 bp
  • G to T, chromosome 1 at 165,140,140 bp
  • T to A, chromosome 1 at 172,497,163 bp
  • T to C, chromosome 2 at 26,960,271 bp
  • T to G, chromosome 2 at 62,787,904 bp
  • T to A, chromosome 2 at 105,685,923 bp
  • T to C, chromosome 3 at 26,133,647 bp
  • T to C, chromosome 3 at 55,207,686 bp
  • A to T, chromosome 3 at 64,287,455 bp
  • T to C, chromosome 5 at 25,517,939 bp
  • C to T, chromosome 7 at 25,046,355 bp
  • T to A, chromosome 7 at 28,107,356 bp
  • G to A, chromosome 7 at 30,056,287 bp
  • A to G, chromosome 7 at 41,374,808 bp
  • A to G, chromosome 7 at 45,498,865 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to G, chromosome 8 at 45,026,404 bp
  • A to G, chromosome 8 at 83,668,650 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to T, chromosome 8 at 105,985,241 bp
  • G to A, chromosome 8 at 106,265,964 bp
  • T to C, chromosome 9 at 57,960,336 bp
  • T to C, chromosome 9 at 77,031,702 bp
  • T to C, chromosome 9 at 111,272,556 bp
  • G to T, chromosome 9 at 111,439,337 bp
  • T to C, chromosome 9 at 120,562,038 bp
  • T to C, chromosome 11 at 33,964,686 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • G to A, chromosome 11 at 102,776,675 bp
  • T to C, chromosome 11 at 120,287,721 bp
  • A to T, chromosome 12 at 66,284,213 bp
  • C to T, chromosome 12 at 69,650,649 bp
  • G to A, chromosome 13 at 34,747,101 bp
  • A to G, chromosome 13 at 55,541,691 bp
  • T to C, chromosome 14 at 24,003,744 bp
  • T to A, chromosome 14 at 31,736,840 bp
  • G to A, chromosome 14 at 105,893,357 bp
  • G to A, chromosome 15 at 89,531,627 bp
  • A to G, chromosome 15 at 98,849,459 bp
  • T to C, chromosome 16 at 17,640,233 bp
  • G to A, chromosome 16 at 21,922,263 bp
  • T to C, chromosome 16 at 96,041,274 bp
  • T to C, chromosome 16 at 97,746,036 bp
  • C to T, chromosome 17 at 30,986,554 bp
  • C to T, chromosome 17 at 34,287,677 bp
  • A to G, chromosome 17 at 43,627,215 bp
  • A to T, chromosome 17 at 57,080,904 bp
  • T to C, chromosome 17 at 74,580,382 bp
  • A to T, chromosome 17 at 74,598,044 bp
  • A to T, chromosome 19 at 39,536,817 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6822 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044934-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.