Strain Name:
C57BL/6J-MtgxR6998Btlr/Mmmh
Stock Number:
045010-MU
Citation ID:
RRID:MMRRC_045010-MU
Other Names:
R6998 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb2, 9930031C03Rik, Spnb-2, brain spectrin, non-erythrocytic, elf1, elf3, spectrin G
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: 0610010D24Rik, Daple
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: Cdc2l1, CDK11-p110, CDK11-p58, CDK11-p46, Cdc2l2, PITSLRE proteins
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Luzp1
Name: leucine zipper protein 1
Synonyms: 2700072H04Rik, Luzp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Odf2
Name: outer dense fiber of sperm tails 2
Synonyms: MMTEST29, cenexin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18286
HGNC: HGNC:8114
Homologene: 1907
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: Elys, 6230412P20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Mbtd1
Name: mbt domain containing 1
Synonyms: hemp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103537
Homologene: 41185
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72656
Homologene: 9888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: MCPH5, Sha1, Aspm, D330028K02Rik, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Gpatch2l
Name: G patch domain containing 2 like
Synonyms: 1700020O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70373
VEGA: 12
Homologene: 9942
Pole2
Name: polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms: DNA polymerase epsilon small subunit
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18974
VEGA: 12
HGNC: HGNC:9178
Homologene: 2015
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: C21, C230089I12Rik, TBLR1, Ira1, A630076E03Rik, DC42, 8030499H02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81004
Homologene: 69382
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Sgo2a
Name: shugoshin 2A
Synonyms: Sgol2a, 1110007N04Rik, Tripin, 5730576N04Rik, D1Ertd8e, Sgol2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68549
Homologene: 51867
Ccp110
Name: centriolar coiled coil protein 110
Synonyms: CP110, 6330503K22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101565
Homologene: 8810
Sh3glb2
Name: SH3-domain GRB2-like endophilin B2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227700
Homologene: 10595
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Napb
Name: N-ethylmaleimide sensitive fusion protein attachment protein beta
Synonyms: I47, Brp14, b-SNAP, SNARE, E161
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17957
Homologene: 5332
Adam30
Name: a disintegrin and metallopeptidase domain 30
Synonyms: 4933424D07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71078
HGNC: HGNC:208
Homologene: 11038
Thyn1
Name: thymocyte nuclear protein 1
Synonyms: Thy28, D730042P09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77862
VEGA: 9
Homologene: 8575
Rfx7
Name: regulatory factor X, 7
Synonyms: 9930116O05Rik, Rfxdc2, 2510005N23Rik, D130086K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319758
Homologene: 11275
Limd2
Name: LIM domain containing 2
Synonyms: 0610025L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67803
Homologene: 12731
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3 like, Mar2, Mart2, MEF3L, HB-1, MyEF-3, Edr, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
C1rl
Name: complement component 1, r subcomponent-like
Synonyms: C1r-LP, C1rl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232371
Homologene: 9559
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, PC5A, SPC6, b2b1549Clo, PC5/6A, b2b585Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Lgsn
Name: lengsin, lens protein with glutamine synthetase domain
Synonyms: Lgs, lengsin, Gluld1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 266744
Homologene: 9569
Slc16a10
Name: solute carrier family 16 (monocarboxylic acid transporters), member 10
Synonyms: TAT1, Mct10, PRO0813, 2610103N14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72472
VEGA: 10
Homologene: 75089
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: D18Bwg1409e, Sdccag33, 5730407I04Rik, NY-CO-33, Mtsh1, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Dab2
Name: disabled 2, mitogen-responsive phosphoprotein
Synonyms: D15Wsu122e, 5730435J12Rik, p96, D630005B22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13132
HGNC: HGNC:2662
Homologene: 1026
Akr1c21
Name: aldo-keto reductase family 1, member C21
Synonyms: 9430025F20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77337
Homologene: 134114
Card14
Name: caspase recruitment domain family, member 14
Synonyms: CARMA2, Bimp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170720
Homologene: 11469
Garem2
Name: GRB2 associated regulator of MAPK1 subtype 2
Synonyms: Fam59b, LOC242915, Gareml
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242915
Homologene: 19063
Fndc7
Name: fibronectin type III domain containing 7
Synonyms: E230011A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320181
Homologene: 18551
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Or4s2b
Name: olfactory receptor family 4 subfamily S member 2B
Synonyms: MOR230-9, Olfr1194-ps1, Olfr1193, GA_x6K02T2Q125-50154044-50154826, GA_x6K02T2Q125-50158288-50158818, MOR226-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329460
Homologene: 27297
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Decr1
Name: 2,4-dienoyl CoA reductase 1, mitochondrial
Synonyms: Decr, 1200012F07Rik, Nadph
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67460
HGNC: HGNC:2753
Homologene: 68178
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: Olfr1082, MOR192-4_p, GA_x6K02T2Q125-48079993-48079157
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Itga3
Name: integrin alpha 3
Synonyms: alpha3-integrin, VLA-3 alpha 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Mfhas1
Name: malignant fibrous histiocytoma amplified sequence 1
Synonyms: 2310066G09Rik, D8Ertd91e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52065
Homologene: 3114
Krt79
Name: keratin 79
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223917
Homologene: 89169
Aspg
Name: asparaginase
Synonyms: A530050D06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104816
VEGA: 12
Homologene: 113390
Zfp663
Name: zinc finger protein 663
Synonyms: LOC381405, Gm1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381405
Homologene: 128277
Or11g7
Name: olfactory receptor family 11 subfamily G member 7
Synonyms: GA_x6K02T2PMLR-6167145-6168080, MOR106-4, Olfr740
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258661
Cyp8b1
Name: cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms: sterol 12-alpha-hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13124
HGNC: HGNC:2653
Homologene: 3233
Alg9
Name: ALG9 alpha-1,2-mannosyltransferase
Synonyms: B430313H07Rik, Dibd1, 8230402H15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102580
Homologene: 6756
Igkv6-13
Name: immunoglobulin kappa variable 6-13
Synonyms: kappa-tnp V-J
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667899
HGNC: HGNC:5834
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 31,204,193 bp
  • A to G, chromosome 1 at 58,016,640 bp
  • T to G, chromosome 1 at 133,102,372 bp
  • C to T, chromosome 1 at 139,469,472 bp
  • G to A, chromosome 1 at 179,770,915 bp
  • G to T, chromosome 2 at 29,912,617 bp
  • T to A, chromosome 2 at 30,355,321 bp
  • A to T, chromosome 2 at 86,594,144 bp
  • A to T, chromosome 2 at 88,678,508 bp
  • T to C, chromosome 2 at 148,700,425 bp
  • A to T, chromosome 2 at 165,354,002 bp
  • T to A, chromosome 3 at 22,179,290 bp
  • A to G, chromosome 3 at 98,162,710 bp
  • G to A, chromosome 3 at 108,876,648 bp
  • T to A, chromosome 4 at 11,204,537 bp
  • A to G, chromosome 4 at 15,930,960 bp
  • T to C, chromosome 4 at 136,543,444 bp
  • G to A, chromosome 4 at 155,648,343 bp
  • T to A, chromosome 5 at 21,543,689 bp
  • T to C, chromosome 5 at 21,620,613 bp
  • T to C, chromosome 5 at 30,114,170 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to G, chromosome 6 at 70,457,589 bp
  • C to A, chromosome 6 at 91,752,438 bp
  • T to C, chromosome 6 at 124,508,902 bp
  • T to G, chromosome 7 at 10,037,757 bp
  • A to G, chromosome 7 at 118,732,897 bp
  • T to C, chromosome 7 at 141,818,714 bp
  • C to A, chromosome 8 at 35,591,356 bp
  • C to T, chromosome 9 at 13,621,185 bp
  • T to C, chromosome 9 at 27,006,442 bp
  • T to A, chromosome 9 at 50,789,621 bp
  • T to A, chromosome 9 at 72,618,505 bp
  • T to C, chromosome 9 at 121,915,993 bp
  • T to A, chromosome 10 at 4,453,937 bp
  • T to C, chromosome 10 at 40,056,503 bp
  • A to C, chromosome 11 at 7,079,026 bp
  • T to C, chromosome 11 at 30,100,633 bp
  • A to T, chromosome 11 at 93,924,612 bp
  • T to C, chromosome 11 at 95,051,462 bp
  • C to T, chromosome 11 at 106,158,690 bp
  • A to G, chromosome 11 at 119,322,899 bp
  • T to C, chromosome 12 at 69,213,906 bp
  • G to A, chromosome 12 at 86,244,184 bp
  • T to C, chromosome 12 at 100,916,852 bp
  • T to A, chromosome 12 at 112,112,194 bp
  • C to A, chromosome 12 at 115,145,492 bp
  • A to G, chromosome 13 at 4,583,851 bp
  • G to T, chromosome 13 at 11,712,166 bp
  • A to T, chromosome 14 at 50,453,433 bp
  • A to T, chromosome 14 at 50,893,021 bp
  • G to T, chromosome 15 at 6,424,649 bp
  • T to C, chromosome 15 at 101,937,872 bp
  • A to T, chromosome 18 at 84,015,841 bp
  • T to C, chromosome 19 at 17,473,112 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6998 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045010-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.