Strain Name:
C57BL/6J-MtgxR6941Btlr/Mmmh
Stock Number:
045055-MU
Citation ID:
RRID:MMRRC_045055-MU
Other Names:
R6941 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: urehr3, Nkcc2, mBSC1, D630042G03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Atg7
Name: autophagy related 7
Synonyms: Apg7l, 1810013K23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Mtmr3
Name: myotubularin related protein 3
Synonyms: 1700092A20Rik, FYVE-DSP1, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Xtrp1, Gabt1, Gat1, Gabt, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: ANKRD4, Wdt4, C130078N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66894
Homologene: 48490
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: mcIAP1, cIAP1, HIAP1, MIHB, Api1, MIAP1, IAP1, cIAP-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Nek7
Name: NIMA (never in mitosis gene a)-related expressed kinase 7
Synonyms: 2810460C19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59125
Homologene: 69340
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Ddx27
Name: DEAD box helicase 27
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228889
Homologene: 6431
Psat1
Name: phosphoserine aminotransferase 1
Synonyms: EPIP, D8Ertd814e, PSA
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107272
Homologene: 6973
Nufip2
Name: nuclear FMR1 interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68564
Homologene: 10808
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Ipmk
Name: inositol polyphosphate multikinase
Synonyms: 2410017C19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69718
Homologene: 76214
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: 1200014F01Rik, Ampd-2, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: 2610100B16Rik, Odz3, Ten-m3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78787
Homologene: 90902
Pglyrp2
Name: peptidoglycan recognition protein 2
Synonyms: Pglyrpl, tagl-beta, C730002N09Rik, PGRP-L, tagL-alpha, tagL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57757
VEGA: 17
Homologene: 49671
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Qrfprl
Name: pyroglutamylated RFamide peptide receptor like
Synonyms: C130060K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243407
Homologene: 135976
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: D030022P06Rik, F630004O05Rik, B930091H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: TRPP5, Polycystin - L2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Cabp1
Name: calcium binding protein 1
Synonyms: caldendrin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29867
HGNC: HGNC:1384
Homologene: 99790
Gdf15
Name: growth differentiation factor 15
Synonyms: NAG-1, MIC-1, macrophage inhibiting cytokine-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23886
Homologene: 3576
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: SMAalpha, SMalphaA, Actvs, 0610041G09Rik, alphaSMA, a-SMA
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Acad10
Name: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: 2410021P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71985
Homologene: 49825
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, mKIAA0811, LOC245827, Fath2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Cd180
Name: CD180 antigen
Synonyms: Ly78, RP105
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: D16Ertd536e, 2310045H19Rik, 2810426P10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 4833414G05Rik, 2010200K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
AU018091
Name: expressed sequence AU018091
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245128
Homologene: 106376
Slc1a4
Name: solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms: ASCT1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55963
Homologene: 20655
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Rad51d
Name: RAD51 paralog D
Synonyms: R51H3, Rad51l3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19364
HGNC: HGNC:9823
Homologene: 2156
Lrit1
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Synonyms: Lrrc21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239037
Homologene: 9215
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: 4930544G21Rik, SKIP, A930009L15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Or5b99
Name: olfactory receptor family 5 subfamily B member 99
Synonyms: Olfr1451, MOR202-1, GA_x6K02T2RE5P-3328502-3329434
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258700
HGNC: HGNC:8323
Homologene: 128082
Lrrc34
Name: leucine rich repeat containing 34
Synonyms: Spata34, 1700007J06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71827
Homologene: 27419
Fjx1
Name: four jointed box 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14221
Homologene: 7717
Dsc1
Name: desmocollin 1
Synonyms: Dsc1b, Dsc1a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Zfy2
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22768
Homologene: 56456
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Tacr1
Name: tachykinin receptor 1
Synonyms: NK1-R, substance p receptor, SPr, Tac1r, NK1 receptor, NK-1R, neurokinin receptor 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21336
Homologene: 20288
Rnf19b
Name: ring finger protein 19B
Synonyms: Ibrdc3, 4930534K13Rik, 4930555L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75234
Homologene: 34999
Cnksr3
Name: Cnksr family member 3
Synonyms: Magi1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215748
Homologene: 18192
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: D1Mgi1, 9230107O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Spesp1
Name: sperm equatorial segment protein 1
Synonyms: 4921508E09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66712
VEGA: 9
Homologene: 49838
Gvin2
Name: GTPase, very large interferon inducible, family member 2
Synonyms: Gm4070
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042856
Homologene: 32708
Frmd3
Name: FERM domain containing 3
Synonyms: 4.1O, P410, 9430066I12Rik, EPB41L4O
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242506
Homologene: 16012
Klk1b8
Name: kallikrein 1-related peptidase b8
Synonyms: TADG14, Klk8, mGK-8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16624
Homologene: 68141
Epm2a
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: laforin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13853
HGNC: HGNC:3413
Homologene: 38087
Rell2
Name: RELT-like 2
Synonyms: 4631403P03Rik, ependolin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225392
Homologene: 17819
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,405,844 bp
  • G to A, chromosome 1 at 83,408,090 bp
  • G to T, chromosome 1 at 130,847,327 bp
  • T to C, chromosome 1 at 138,502,638 bp
  • A to G, chromosome 2 at 102,450,558 bp
  • G to T, chromosome 2 at 125,214,079 bp
  • A to T, chromosome 2 at 158,696,148 bp
  • A to G, chromosome 2 at 167,015,377 bp
  • T to C, chromosome 3 at 30,624,820 bp
  • T to C, chromosome 3 at 108,079,293 bp
  • T to G, chromosome 3 at 125,609,511 bp
  • A to G, chromosome 4 at 74,098,126 bp
  • T to C, chromosome 4 at 129,082,779 bp
  • A to T, chromosome 5 at 115,172,901 bp
  • A to T, chromosome 5 at 121,649,357 bp
  • G to A, chromosome 6 at 65,447,401 bp
  • A to G, chromosome 6 at 82,403,865 bp
  • G to A, chromosome 6 at 114,313,512 bp
  • C to T, chromosome 6 at 114,673,678 bp
  • A to G, chromosome 7 at 3,159,427 bp
  • C to A, chromosome 7 at 43,952,789 bp
  • G to A, chromosome 7 at 105,901,980 bp
  • A to T, chromosome 7 at 120,541,147 bp
  • A to G, chromosome 7 at 127,542,597 bp
  • G to A, chromosome 8 at 27,156,275 bp
  • T to C, chromosome 8 at 48,674,416 bp
  • G to A, chromosome 8 at 55,940,926 bp
  • A to G, chromosome 8 at 70,630,144 bp
  • T to A, chromosome 8 at 107,548,502 bp
  • A to G, chromosome 9 at 7,819,468 bp
  • A to G, chromosome 9 at 62,272,870 bp
  • A to G, chromosome 10 at 7,126,758 bp
  • A to G, chromosome 10 at 11,391,085 bp
  • A to G, chromosome 10 at 18,625,455 bp
  • T to C, chromosome 10 at 62,430,586 bp
  • G to A, chromosome 10 at 71,348,090 bp
  • T to C, chromosome 11 at 4,487,505 bp
  • A to G, chromosome 11 at 20,304,346 bp
  • T to C, chromosome 11 at 55,262,088 bp
  • A to T, chromosome 11 at 73,690,333 bp
  • CCAGCAGCAGCAGCAGCAGCAG to CCAGCAGCAGCAGCAGCAG, chromosome 11 at 77,686,296 bp
  • A to G, chromosome 11 at 82,889,797 bp
  • T to C, chromosome 12 at 4,629,641 bp
  • A to T, chromosome 12 at 114,583,828 bp
  • A to T, chromosome 13 at 102,706,191 bp
  • A to T, chromosome 13 at 102,804,714 bp
  • T to G, chromosome 14 at 20,562,109 bp
  • G to C, chromosome 14 at 37,060,095 bp
  • C to A, chromosome 15 at 78,446,777 bp
  • TAGTAAGAGT to TAGT, chromosome 16 at 70,433,556 bp
  • T to C, chromosome 17 at 32,416,074 bp
  • T to C, chromosome 18 at 20,097,189 bp
  • C to T, chromosome 18 at 20,267,923 bp
  • G to T, chromosome 18 at 34,416,883 bp
  • G to A, chromosome 18 at 37,958,288 bp
  • T to A, chromosome 19 at 12,999,497 bp
  • A to T, chromosome 19 at 15,920,943 bp
  • A to T, chromosome 19 at 34,252,522 bp
  • T to C, chromosome Y at 2,121,491 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6941 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045055-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.