Strain Name:
C57BL/6J-MtgxR7579Btlr/Mmmh
Stock Number:
045633-MU
Citation ID:
RRID:MMRRC_045633-MU
Other Names:
R7579 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: Ank-2, Gm4392, Ankyrin-B, ankyrin B, Ankyrin-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Vcan
Name: versican
Synonyms: 5430420N07Rik, DPEAAE, PG-M, heart defect, Cspg2, hdf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Sgcd
Name: sarcoglycan, delta (dystrophin-associated glycoprotein)
Synonyms: delta-SG
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24052
Homologene: 285
Gstt2
Name: glutathione S-transferase, theta 2
Synonyms: Yrs, mGSTT2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14872
VEGA: 10
Homologene: 37358
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Slc21a7, Oatp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: Fnbp2, FBP2, 9930124L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Syt3
Name: synaptotagmin III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20981
Homologene: 9617
Zranb2
Name: zinc finger, RAN-binding domain containing 2
Synonyms: Znf265, Zfp265, Zis
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53861
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Gars, GENA202, Sgrp23, Gena201
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Orc5
Name: origin recognition complex, subunit 5
Synonyms: MmORC5, mouse origin recognition complex 5, Orc5l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26429
HGNC: HGNC:8491
Homologene: 37636
Ptbp1
Name: polypyrimidine tract binding protein 1
Synonyms: hnRNP I, Ptb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19205
HGNC: HGNC:9583
Homologene: 49188
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: A330049M09Rik, nesprin-1, C130039F11Rik, enaptin165, SYNE-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Klf10
Name: Kruppel-like transcription factor 10
Synonyms: mGIF, Gdnfif, Egral, Tieg1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21847
VEGA: 15
Homologene: 4135
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Rbm33
Name: RNA binding motif protein 33
Synonyms: Prr8, 6430512A10Rik, 3200001K10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381626
Homologene: 137386
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: Tem5-like, 3830613O22Rik, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Gad1
Name: glutamate decarboxylase 1
Synonyms: EP10, Z49976, Gad-1, GAD25, GAD44, GAD67
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Zdhhc11
Name: zinc finger, DHHC domain containing 11
Synonyms: 4933421L13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71164
VEGA: 13
Homologene: 128723
Prlr
Name: prolactin receptor
Synonyms: Pr-1, Prlr-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19116
HGNC: HGNC:9446
Homologene: 733
Ttn
Name: titin
Synonyms: mdm, D830007G01Rik, shru, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, 2310036G12Rik, 2310074I15Rik, L56, connectin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Dhx36
Name: DEAH-box helicase 36
Synonyms: RHAU, Ddx36, 2810407E23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72162
Homologene: 6356
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: 4921531P07Rik, Dnahc12, DHC3, HL19, DLP12, HL-19, Hdhc3, Dnahc7l, LOC380889
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Gm5134
Name: predicted gene 5134
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 333669
Homologene: 129891
Vmn1r73
Name: vomeronasal 1 receptor 73
Synonyms: V1rg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171237
Homologene: 103842
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: C330021K24Rik, 5830437M04Rik, Gababrbp, Marlin-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210198
VEGA: 10
Homologene: 17529
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: D18Bwg1409e, Sdccag33, 5730407I04Rik, NY-CO-33, Mtsh1, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Cdc20b
Name: cell division cycle 20B
Synonyms: EG622422, EG238896
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238896
Homologene: 65056
Cfh
Name: complement component factor h
Synonyms: Sas1, Sas-1, Mud-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Mmd2
Name: monocyte to macrophage differentiation-associated 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75104
Homologene: 18425
Icam2
Name: intercellular adhesion molecule 2
Synonyms: Icam-2, CD102
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15896
HGNC: HGNC:5345
Homologene: 675
Slc22a13
Name: solute carrier family 22 (organic cation transporter), member 13
Synonyms: OCTL3, OCTL1, ORCTL3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102570
VEGA: 9
HGNC: HGNC:8494
Homologene: 3140
Or2b7
Name: olfactory receptor family 2 subfamily B member 7
Synonyms: GA_x6K02T2QHY8-11688984-11689964, MOR256-36, Olfr1365, MOR256-36, MOR256-63, Olfr1535
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 404335
Homologene: 131356
Acsm4
Name: acyl-CoA synthetase medium-chain family member 4
Synonyms: O-MACS, OMACS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233801
Homologene: 72281
Fcrlb
Name: Fc receptor-like B
Synonyms: FREB-2, FREB2, mFCRL2, Fcry, FcRL2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435653
Homologene: 83202
Or8k32
Name: olfactory receptor family 8 subfamily K member 32
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1, Olfr1079
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258402
Homologene: 74090
Slc25a31
Name: solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Synonyms: 1700034J06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73333
Homologene: 69485
Slc37a4
Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4
Synonyms: G6pt1, G6PT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14385
VEGA: 9
HGNC: HGNC:4061
Homologene: 37482
Dio1
Name: deiodinase, iodothyronine, type I
Synonyms: D1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13370
HGNC: HGNC:2883
Homologene: 620
Gm11444
Name: predicted gene 11444
Type: Gene
Species: Mouse
Chromosome: 11
Gldn
Name: gliomedin
Synonyms: CRG-L2, Crlg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235379
Homologene: 14529
Or10w3
Name: olfactory receptor family 10 subfamily W member 3
Synonyms: Olfr1493, GA_x6K02T2RE5P-4059239-4060188, MOR266-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258735
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 131,292,633 bp
  • T to G, chromosome 1 at 140,108,590 bp
  • T to C, chromosome 1 at 170,907,847 bp
  • T to C, chromosome 2 at 37,858,432 bp
  • T to A, chromosome 2 at 70,587,132 bp
  • G to A, chromosome 2 at 76,782,388 bp
  • C to T, chromosome 2 at 86,538,528 bp
  • A to T, chromosome 3 at 40,725,040 bp
  • T to C, chromosome 3 at 62,480,873 bp
  • A to G, chromosome 3 at 126,946,398 bp
  • A to G, chromosome 3 at 157,540,672 bp
  • A to T, chromosome 4 at 11,265,909 bp
  • C to T, chromosome 4 at 107,292,386 bp
  • A to G, chromosome 5 at 22,550,199 bp
  • C to T, chromosome 5 at 28,368,266 bp
  • T to G, chromosome 5 at 37,127,458 bp
  • C to A, chromosome 5 at 49,987,635 bp
  • T to C, chromosome 5 at 108,845,082 bp
  • A to T, chromosome 5 at 142,608,606 bp
  • A to G, chromosome 6 at 55,077,703 bp
  • A to G, chromosome 6 at 142,275,481 bp
  • G to T, chromosome 7 at 11,757,155 bp
  • T to A, chromosome 7 at 44,390,848 bp
  • A to G, chromosome 7 at 80,258,233 bp
  • G to T, chromosome 7 at 119,693,710 bp
  • A to T, chromosome 8 at 25,896,658 bp
  • C to A, chromosome 9 at 26,883,826 bp
  • G to A, chromosome 9 at 44,401,521 bp
  • A to G, chromosome 9 at 54,338,364 bp
  • A to G, chromosome 9 at 119,195,160 bp
  • T to C, chromosome 10 at 5,349,324 bp
  • T to A, chromosome 10 at 10,410,818 bp
  • C to T, chromosome 10 at 51,626,787 bp
  • A to C, chromosome 10 at 62,435,708 bp
  • C to A, chromosome 10 at 62,435,709 bp
  • A to T, chromosome 10 at 75,834,185 bp
  • T to C, chromosome 10 at 75,964,437 bp
  • A to G, chromosome 10 at 79,859,120 bp
  • CCC to CCCC, chromosome 10 at 81,178,768 bp
  • C to A, chromosome 10 at 121,476,198 bp
  • C to G, chromosome 11 at 47,125,654 bp
  • A to G, chromosome 11 at 85,850,243 bp
  • A to G, chromosome 11 at 106,380,763 bp
  • A to T, chromosome 13 at 21,556,006 bp
  • T to A, chromosome 13 at 73,982,766 bp
  • T to C, chromosome 13 at 89,692,458 bp
  • A to T, chromosome 13 at 113,037,048 bp
  • A to G, chromosome 14 at 26,770,503 bp
  • G to T, chromosome 15 at 4,931,061 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to G, chromosome 15 at 10,328,935 bp
  • A to G, chromosome 15 at 38,297,038 bp
  • T to C, chromosome 17 at 21,722,926 bp
  • A to T, chromosome 18 at 84,014,665 bp
  • T to C, chromosome 19 at 13,727,101 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7579 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045633-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.