Strain Name:
C57BL/6J-MtgxR8225Btlr/Mmmh
Stock Number:
067642-MU
Citation ID:
RRID:MMRRC_067642-MU
Other Names:
R8225 (G1)
Major Collection:

Strain Information

Cdk6
Name: cyclin dependent kinase 6
Synonyms: Crk2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12571
HGNC: HGNC:1777
Homologene: 963
Prdm16
Name: PR domain containing 16
Synonyms: line 27, 5730557K01Rik, csp1, Mel1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: NBCn1, NBC3, E430014N10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Tfr2
Name: transferrin receptor 2
Synonyms: Trfr2, Tfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: eIF2C3, argonaute 3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, Epb4.1l3, 4.1B, DAL1P
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Fndc3a
Name: fibronectin type III domain containing 3A
Synonyms: Fndc3, sys, 1700094E19Rik, D14Ertd453e, F730017H24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319448
Homologene: 8952
Kars1
Name: lysyl-tRNA synthetase 1
Synonyms: D8Wsu108e, D8Ertd698e, Kars, LysRS
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 85305
HGNC: HGNC:6215
Homologene: 4053
Clock
Name: clock circadian regulator
Synonyms: bHLHe8, KAT13D, 5330400M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: C330002D13Rik, 2310042E16Rik, Coh1, 1810042B05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: LTRPC4, 1110030C19Rik, TRPM4B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Uty
Name: ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Synonyms: Hydb
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22290
Kcnj3
Name: potassium inwardly-rectifying channel, subfamily J, member 3
Synonyms: Kcnf3, GIRK1, Kir3.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16519
HGNC: HGNC:6264
Homologene: 1687
Nsun2
Name: NOL1/NOP2/Sun domain family member 2
Synonyms: Misu
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 28114
Homologene: 9817
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: 1700069J21Rik, D6Ertd772e, TXBP151, D6Ertd404e, T6BP, 1200003J11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52440
Homologene: 4395
Exosc10
Name: exosome component 10
Synonyms: PM/Scl-100, p3, RRP6, p2, p4, Pmscl2, PM-Scl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Gzf1
Name: GDNF-inducible zinc finger protein 1
Synonyms: 8430437G08Rik, Zfp336
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74533
Homologene: 11200
Ythdc1
Name: YTH domain containing 1
Synonyms: A730098D12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231386
Homologene: 15796
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 282619
Homologene: 17900
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: 9830168K16Rik, TRPC7, Trrp7, LTRPC2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cacnl1a2, C79217, 8430418G19Rik, Cav1.3alpha1, Cchl1a2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Dock10
Name: dedicator of cytokinesis 10
Synonyms: A630054M16Rik, ZIZ3, 9330153B10Rik, Jr4, Jr5, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Synm
Name: synemin, intermediate filament protein
Synonyms: Synemin, 4930412K21Rik, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Vipr1
Name: vasoactive intestinal peptide receptor 1
Synonyms: VPAC1, VIP receptor subtype 1, VIP-R1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22354
Homologene: 3399
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Tns1
Name: tensin 1
Synonyms: E030018G17Rik, 1200014E20Rik, E030037J05Rik, Tns, 1110018I21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Sult6b2
Name: sulfotransferase family 6B, member 2
Synonyms: Gm766, LOC330440
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330440
Homologene: 66632
Or5b107
Name: olfactory receptor family 5 subfamily B member 107
Synonyms: Olfr1461, MOR202-35, GA_x6K02T2RE5P-3491834-3492772
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258299
HGNC: HGNC:8324
Homologene: 128112
Zfp521
Name: zinc finger protein 521
Synonyms: Evi3, B930086A16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2-d, Slp2-a, Slp2, Slp2-b, Slp2-c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Dynlt1a
Name: dynein light chain Tctex-type 1A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100310872
VEGA: 17
Homologene: 4754
Kcnk10
Name: potassium channel, subfamily K, member 10
Synonyms: 1700024D23Rik, 3010005K24Rik, Trek2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72258
VEGA: 12
HGNC: HGNC:6273
Homologene: 11321
Dnajb8
Name: DnaJ heat shock protein family (Hsp40) member B8
Synonyms: mDj6, 1700016F14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56691
Homologene: 23184
Fabp3-ps1
Name: fatty acid binding protein 3, muscle and heart, pseudogene 1
Synonyms: Fabph-3, Fabph3, Fabph-ps1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14074
VEGA: 10
Zbtb9
Name: zinc finger and BTB domain containing 9
Synonyms: 3930402F13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 474156
Homologene: 45145
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Gpr146
Name: G protein-coupled receptor 146
Synonyms: PGR8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80290
Homologene: 36472
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Nagpa
Name: N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Synonyms: UCE, alpha-GlcNAcase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27426
Homologene: 8466
Ube2q2l
Name: ubiquitin conjugating enzyme E2 Q2 like
Synonyms: E330021D16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100502936
Pax8
Name: paired box 8
Synonyms: Pax-8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18510
HGNC: HGNC:8622
Homologene: 2589
Gm10645
Name: predicted gene 10645
Type: Gene
Species: Mouse
Chromosome: 8
Defa42
Name: defensin, alpha, 42
Synonyms: Gm7849
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 665927
Homologene: 85974
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 25,826,516 bp
  • G to A, chromosome 1 at 73,985,887 bp
  • T to A, chromosome 1 at 80,503,730 bp
  • A to C, chromosome 1 at 151,422,108 bp
  • A to T, chromosome 2 at 24,422,971 bp
  • G to A, chromosome 2 at 55,437,714 bp
  • T to A, chromosome 2 at 148,690,844 bp
  • A to T, chromosome 4 at 126,353,739 bp
  • G to A, chromosome 4 at 148,565,204 bp
  • A to G, chromosome 4 at 154,355,245 bp
  • C to A, chromosome 5 at 3,390,790 bp
  • T to C, chromosome 5 at 76,241,912 bp
  • A to T, chromosome 5 at 86,816,937 bp
  • G to T, chromosome 5 at 86,816,938 bp
  • G to A, chromosome 5 at 137,571,463 bp
  • A to T, chromosome 5 at 139,392,616 bp
  • A to G, chromosome 6 at 32,162,103 bp
  • G to A, chromosome 6 at 52,744,355 bp
  • C to T, chromosome 6 at 88,222,958 bp
  • A to T, chromosome 6 at 136,401,112 bp
  • A to T, chromosome 6 at 142,804,329 bp
  • TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG to TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG, chromosome 7 at 30,751,994 bp
  • T to C, chromosome 7 at 30,752,444 bp
  • A to G, chromosome 7 at 45,305,334 bp
  • A to C, chromosome 7 at 67,759,049 bp
  • G to A, chromosome 7 at 90,375,517 bp
  • T to C, chromosome 8 at 21,456,402 bp
  • C to T, chromosome 8 at 83,165,838 bp
  • T to C, chromosome 8 at 112,003,338 bp
  • G to T, chromosome 9 at 78,661,690 bp
  • T to A, chromosome 9 at 96,035,667 bp
  • T to A, chromosome 9 at 108,107,106 bp
  • CACACACACAGA to CA, chromosome 9 at 119,160,708 bp
  • A to T, chromosome 9 at 121,642,849 bp
  • C to T, chromosome 10 at 77,947,973 bp
  • T to C, chromosome 10 at 86,000,567 bp
  • A to G, chromosome 10 at 86,732,234 bp
  • A to G, chromosome 11 at 116,454,068 bp
  • A to G, chromosome 12 at 98,440,590 bp
  • T to C, chromosome 13 at 69,612,374 bp
  • C to T, chromosome 14 at 14,738,224 bp
  • A to G, chromosome 14 at 30,123,033 bp
  • T to C, chromosome 14 at 72,557,677 bp
  • A to G, chromosome 15 at 35,794,382 bp
  • C to A, chromosome 16 at 5,198,860 bp
  • G to T, chromosome 17 at 6,311,353 bp
  • T to A, chromosome 17 at 26,974,785 bp
  • C to T, chromosome 17 at 69,274,801 bp
  • T to C, chromosome 18 at 13,845,302 bp
  • A to T, chromosome 19 at 13,165,143 bp
  • T to C, chromosome Y at 1,158,634 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8225 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067642-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.