Strain Name:
C57BL/6J-MtgxR8392Btlr/Mmmh
Stock Number:
067757-MU
Citation ID:
RRID:MMRRC_067757-MU
Other Names:
R8392 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: SpbIV, ROSA62, neuroaxonal dystrophy, dyn, 1700022P15Rik, 5830426A08Rik, nmf261, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Top1
Name: topoisomerase (DNA) I
Synonyms: D130064I21Rik, Top-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: A230094E16Rik, neurabin-I, 4930518N04Rik, Neurabin I, NRB, 2810430P21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: D130075K09Rik, LEC3, lectomedin 3, Lphn3, 5430402I23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Kdsr
Name: 3-ketodihydrosphingosine reductase
Synonyms: Fvt1, 6330410P18Rik, 9430079B08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70750
HGNC: HGNC:4021
Homologene: 1539
Erbin
Name: Erbb2 interacting protein
Synonyms: Erbb2ip, 1700028E05Rik, Erbin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59079
Homologene: 41282
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, 4832420A03Rik, Hbxap, C030033M12Rik, XAP8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276829
Homologene: 82367
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104662
Homologene: 5576
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Ctsc
Name: cathepsin C
Synonyms: DPP1, dipeptidylpeptidase 1, DPPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Wcrf180, Gtl5, Acf1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Cdv3
Name: carnitine deficiency-associated gene expressed in ventricle 3
Synonyms: C230084J24Rik, TPP36, 2510010F10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321022
Homologene: 133862
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Ccl2
Name: C-C motif chemokine ligand 2
Synonyms: MCP-1, SMC-CF, MCAF, monocyte chemoattractant protein-1, Sigje, monocyte chemotactic protein, HC11, MCP1, Scya2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20296
Homologene: 2241
Crppa
Name: CDP-L-ribitol pyrophosphorylase A
Synonyms: Ispd, 4930579E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75847
VEGA: 12
Homologene: 45614
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: 4921531P07Rik, Dnahc12, DHC3, HL19, DLP12, HL-19, Hdhc3, Dnahc7l, LOC380889
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Or1j20
Name: olfactory receptor family 1 subfamily J member 20
Synonyms: MOR136-10, Olfr352, GA_x6K02T2NLDC-33564136-33565083
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258942
Homologene: 121523
Cyp4a10
Name: cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms: Msp-3, Cyp4a, D4Rp1, RP1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13117
HGNC: HGNC:2642
Homologene: 128044
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72902
Homologene: 9662
Ly75
Name: lymphocyte antigen 75
Synonyms: DEC-205, CD205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
Snip1
Name: Smad nuclear interacting protein 1
Synonyms: 2410133M08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76793
Homologene: 110886
Npsr1
Name: neuropeptide S receptor 1
Synonyms: 9330128H10Rik, PGR14, Gpr154, VRR1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319239
Homologene: 45515
Nebl
Name: nebulette
Synonyms: D830029A09Rik, Lnebl, 1200007O21Rik, A630080F05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Del(8)44H, alpha1(IV) collagen, Bru, Svc, Raw, Col4a-1, Del(8)Bru44H
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: MP-1, 2310012C15Rik, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106347
Homologene: 15892
Plxnc1
Name: plexin C1
Synonyms: CD232, 2510048K12Rik, vespr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Cpeb3
Name: cytoplasmic polyadenylation element binding protein 3
Synonyms: 4831444O18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 208922
Homologene: 40992
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73910
Homologene: 14135
Muc13
Name: mucin 13, epithelial transmembrane
Synonyms: 114/A10, Ly64
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17063
HGNC: HGNC:7511
Homologene: 7822
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: p130, 4732493F09Rik, 1700003B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226407
Homologene: 45617
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78749
Homologene: 37121
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Cyp8b1
Name: cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms: sterol 12-alpha-hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13124
HGNC: HGNC:2653
Homologene: 3233
Tnfsf13
Name: tumor necrosis factor (ligand) superfamily, member 13
Synonyms: TRDL1, TALL2, 2310026N09Rik, APRIL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69583
Homologene: 56971
Or6c213
Name: olfactory receptor family 6 subfamily C member 213
Synonyms: Olfr806, GA_x6K02T2PULF-11417610-11416669, MOR110-12, MOR110-5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258546
Homologene: 73936
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Pcdha11
Name: protocadherin alpha 11
Synonyms: Cnr7, Crnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
H2ac13
Name: H2A clustered histone 13
Synonyms: H2a-291A, Hist1h2ai
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319191
HGNC: HGNC:4724
Homologene: 135791
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 106,743,853 bp
  • A to G, chromosome 1 at 127,938,633 bp
  • T to A, chromosome 2 at 17,452,552 bp
  • T to G, chromosome 2 at 36,870,340 bp
  • T to C, chromosome 2 at 59,806,307 bp
  • T to C, chromosome 2 at 60,349,940 bp
  • T to A, chromosome 2 at 160,717,454 bp
  • A to T, chromosome 4 at 58,070,566 bp
  • C to T, chromosome 4 at 115,529,478 bp
  • G to A, chromosome 4 at 125,066,825 bp
  • G to A, chromosome 5 at 81,646,550 bp
  • A to G, chromosome 5 at 151,042,162 bp
  • T to C, chromosome 6 at 5,143,491 bp
  • T to A, chromosome 6 at 125,880,735 bp
  • C to T, chromosome 7 at 27,372,296 bp
  • A to T, chromosome 7 at 88,297,243 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 7 at 105,703,343 bp
  • T to A, chromosome 8 at 11,208,333 bp
  • A to C, chromosome 8 at 63,355,311 bp
  • T to A, chromosome 9 at 24,310,081 bp
  • T to A, chromosome 9 at 103,355,275 bp
  • T to C, chromosome 9 at 121,915,234 bp
  • A to T, chromosome 10 at 26,845,940 bp
  • T to G, chromosome 10 at 92,962,417 bp
  • A to G, chromosome 10 at 94,801,490 bp
  • T to A, chromosome 10 at 129,738,041 bp
  • T to C, chromosome 11 at 69,683,862 bp
  • T to A, chromosome 11 at 72,403,167 bp
  • C to A, chromosome 11 at 74,900,270 bp
  • A to T, chromosome 11 at 82,036,982 bp
  • T to A, chromosome 12 at 24,990,728 bp
  • T to A, chromosome 12 at 36,390,498 bp
  • T to A, chromosome 12 at 54,923,123 bp
  • T to C, chromosome 13 at 6,549,660 bp
  • C to T, chromosome 13 at 21,716,486 bp
  • T to A, chromosome 13 at 103,834,062 bp
  • T to C, chromosome 14 at 26,885,912 bp
  • A to G, chromosome 14 at 44,858,922 bp
  • G to A, chromosome 16 at 4,084,281 bp
  • G to A, chromosome 16 at 33,799,419 bp
  • G to A, chromosome 16 at 36,722,358 bp
  • G to T, chromosome 16 at 36,722,359 bp
  • A to G, chromosome 16 at 57,571,353 bp
  • T to A, chromosome 18 at 37,006,159 bp
  • TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG, chromosome 19 at 37,174,891 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8392 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067757-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.