Strain Name:
C57BL/6J-MtgxR8400Btlr/Mmmh
Stock Number:
067763-MU
Citation ID:
RRID:MMRRC_067763-MU
Other Names:
R8400 (G1)
Major Collection:

Strain Information

Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 9530077A04Rik, Mll5, 1810033J14Rik, D230038D11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 4930431J08Rik, 9330107J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Spc24
Name: SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms: Spbc24, 2410030K01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67629
VEGA: 9
Homologene: 12166
Csnk1g3
Name: casein kinase 1, gamma 3
Synonyms: C330049O21Rik, 3300002K07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70425
VEGA: 18
HGNC: HGNC:2456
Homologene: 121650
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: Crpd, vomeroglandin, gp300, CRP-[a], MUCLIN, ebnerin, hensin, CRP-[b]
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Fam185a
Name: family with sequence similarity 185, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330050
Homologene: 51828
Fchsd2
Name: FCH and double SH3 domains 2
Synonyms: Sh3md3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207278
Homologene: 8887
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberous sclerosis 2, tuberin, Nafld
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Acad10
Name: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: 2410021P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71985
Homologene: 49825
Cutc
Name: cutC copper transporter
Synonyms: CGI-32, 2310039I18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66388
Homologene: 9318
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Pcdhac1
Name: protocadherin alpha subfamily C, 1
Synonyms: CNRc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353236
HGNC: HGNC:8676
Homologene: 49561
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: Nalp-theta, D7Ertd565e, Nalp9a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Astn1
Name: astrotactin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Acot10
Name: acyl-CoA thioesterase 10
Synonyms: p48, MT-ACT48, Acate3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64833
VEGA: 15
Homologene: 8206
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243874
Homologene: 18530
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Ttc39d
Name: tetratricopeptide repeat domain 39D
Synonyms: 4930560E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67737
Homologene: 65053
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27222
Homologene: 113769
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Or2ag1b
Name: olfactory receptor family 2 subfamily AG member 1B
Synonyms: GA_x6K02T2PBJ9-9067220-9066273, MOR283-9, Olfr694
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258444
Homologene: 79345
Nubp2
Name: nucleotide binding protein 2
Synonyms: D17Wsu11e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26426
VEGA: 17
HGNC: HGNC:8042
Homologene: 8057
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: D030040M08Rik, Snf2h, MommeD4, 4933427E24Rik, D330027N15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Vmn2r22
Name: vomeronasal 2, receptor 22
Synonyms: EG546913
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546913
Homologene: 84037
H2-Q10
Name: histocompatibility 2, Q region locus 10
Synonyms: H-2Q10, Q10, Qa10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15007
Homologene: 128352
Or10q3
Name: olfactory receptor family 10 subfamily Q member 3
Synonyms: MOR266-10, GA_x6K02T2RE5P-2222521-2221490, Olfr1419
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 257938
Homologene: 79473
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: 2410012C07Rik, very-kind, VKIND, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Or7e166
Name: olfactory receptor family 7 subfamily E member 166
Synonyms: MOR146-8P, GA_x6K02T2PVTD-13452606-13453535, Olfr857
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257963
Homologene: 134093
Samhd1
Name: SAM domain and HD domain, 1
Synonyms: E330031J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56045
Homologene: 9160
Or4k45
Name: olfactory receptor family 4 subfamily K member 45
Synonyms: MOR248-10, GA_x6K02T2Q125-72616944-72616006, Olfr1295
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258398
Homologene: 74058
Stra6l
Name: STRA6-like
Synonyms: 1300002K09Rik, Rbpr2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74152
Homologene: 81924
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Or1a1b
Name: olfactory receptor family 1 subfamily A member 1B
Synonyms: Olfr43, MOR125-1, GA_x6K02T2P1NL-4359899-4358958
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258706
Homologene: 8219
Vmn1r158
Name: vomeronasal 1 receptor 158
Synonyms: Gm16455
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043067
Homologene: 104166
Vwa1
Name: von Willebrand factor A domain containing 1
Synonyms: WARP, 4932416A11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246228
Homologene: 11270
Or2b2
Name: olfactory receptor family 2 subfamily B member 2
Synonyms: MOR256-60, MOR256-35, Olfr1359, GA_x6K02T2QHY8-11534186-11533245
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258067
Homologene: 11056
Sppl2b
Name: signal peptide peptidase like 2B
Synonyms: 3110056O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73218
VEGA: 10
Homologene: 10605
Gm904
Name: predicted gene 904
Synonyms: LOC380845, LOC382165
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380845
Homologene: 134520
Ier5l
Name: immediate early response 5-like
Synonyms: 2610524G09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72500
Homologene: 69468
Otud1
Name: OTU domain containing 1
Synonyms: 4933428L19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71198
Homologene: 45953
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 63,304,976 bp
  • C to A, chromosome 1 at 130,636,747 bp
  • C to T, chromosome 1 at 158,657,100 bp
  • T to A, chromosome 1 at 172,234,494 bp
  • T to C, chromosome 2 at 19,658,378 bp
  • A to G, chromosome 2 at 30,473,093 bp
  • A to T, chromosome 2 at 111,565,402 bp
  • T to C, chromosome 2 at 157,099,433 bp
  • G to A, chromosome 4 at 45,864,905 bp
  • T to C, chromosome 4 at 155,772,768 bp
  • T to A, chromosome 5 at 21,438,816 bp
  • C to A, chromosome 5 at 23,497,092 bp
  • A to G, chromosome 5 at 121,626,205 bp
  • A to T, chromosome 6 at 123,637,527 bp
  • T to A, chromosome 7 at 20,024,012 bp
  • A to T, chromosome 7 at 22,789,880 bp
  • A to T, chromosome 7 at 26,565,006 bp
  • A to G, chromosome 7 at 87,002,100 bp
  • A to T, chromosome 7 at 101,253,573 bp
  • T to A, chromosome 7 at 106,689,669 bp
  • C to G, chromosome 7 at 131,082,587 bp
  • C to T, chromosome 7 at 139,913,518 bp
  • C to A, chromosome 7 at 141,810,476 bp
  • T to C, chromosome 8 at 80,709,127 bp
  • C to T, chromosome 8 at 109,623,888 bp
  • T to C, chromosome 8 at 125,232,993 bp
  • A to T, chromosome 9 at 19,713,093 bp
  • A to T, chromosome 9 at 21,757,730 bp
  • T to C, chromosome 9 at 54,383,753 bp
  • A to C, chromosome 9 at 105,774,796 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,572 bp
  • G to A, chromosome 11 at 9,293,925 bp
  • T to C, chromosome 11 at 9,298,218 bp
  • C to T, chromosome 11 at 74,206,395 bp
  • T to C, chromosome 12 at 38,602,838 bp
  • G to A, chromosome 13 at 21,703,915 bp
  • C to A, chromosome 13 at 50,643,417 bp
  • T to C, chromosome 15 at 20,666,172 bp
  • A to T, chromosome 17 at 24,604,987 bp
  • A to C, chromosome 17 at 24,884,465 bp
  • C to T, chromosome 17 at 35,470,477 bp
  • T to C, chromosome 17 at 80,216,005 bp
  • T to A, chromosome 18 at 37,092,400 bp
  • C to T, chromosome 18 at 53,953,288 bp
  • T to A, chromosome 19 at 11,871,214 bp
  • T to C, chromosome 19 at 43,753,205 bp
  • G to A, chromosome 19 at 56,848,649 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8400 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067763-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.