Strain Name:
C57BL/6J-MtgxR8860Btlr/Mmmh
Stock Number:
068678-MU
Citation ID:
RRID:MMRRC_068678-MU
Other Names:
R8860 (G1)
Major Collection:

Strain Information

Gga3
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms: C230037M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 260302
Homologene: 121703
Sparcl1
Name: SPARC-like 1
Synonyms: hevin, mast9, Ecm2, Sc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: C430041B13Rik, 2310016J22Rik, 4921524A02Rik, PINCH1, Lims1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: IKK[a], IKK 1, IKK-1, IKK1, IKKalpha, IKK-alpha, IKK alpha, IkappaB kinase alpha, Chuk1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Atf6
Name: activating transcription factor 6
Synonyms: 9130025P16Rik, Atf6alpha, ESTM49
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Dhx38
Name: DEAH-box helicase 38
Synonyms: Ddx38, Prp16, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Septin7
Name: septin 7
Synonyms: Cdc10, Sept7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235072
VEGA: 9
HGNC: HGNC:1717
Homologene: 1354
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: RPTPgamma, 5430405N12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Fntb
Name: farnesyltransferase, CAAX box, beta
Synonyms: 2010013E13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110606
Homologene: 1535
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: odd-paired homolog, GENA 29, Ku
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Meaf6
Name: MYST/Esa1-associated factor 6
Synonyms: 2810036M01Rik, 2310005N01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70088
Homologene: 11240
C2cd5
Name: C2 calcium-dependent domain containing 5
Synonyms: CDP138, C030008B15Rik, 5730419I09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74741
Homologene: 8873
Hnrnpc
Name: heterogeneous nuclear ribonucleoprotein C
Synonyms: hnRNPC1, Hnrpc, hnRNPC2, hnRNP C2, hnRNP C1, Hnrpc1, Hnrpc2, D14Wsu171e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15381
VEGA: 14
HGNC: HGNC:5035
Homologene: 74524
Vps4b
Name: vacuolar protein sorting 4B
Synonyms: Skd1, 8030489C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20479
Homologene: 37976
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, Cugbp2, B230345P09Rik, ETR-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: 4432404A22Rik, Snf2p
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Crtc1
Name: CREB regulated transcription coactivator 1
Synonyms: TORC1, Mect1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382056
Homologene: 41607
Acr
Name: acrosin prepropeptide
Synonyms: preproacrosin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11434
VEGA: 15
HGNC: HGNC:126
Homologene: 855
Intu
Name: inturned planar cell polarity protein
Synonyms: 9430087H23Rik, Pdzd6, Pdzk6, 9230116I04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 380614
Homologene: 41059
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Or2ak7
Name: olfactory receptor family 2 subfamily AK member 7
Synonyms: MOR285-4, GA_x6K02T2NKPP-730312-729392, GA_x6K02T2NKPP-733777-732813, MOR285-5, Olfr320, Olfr321-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216783
Homologene: 133825
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MM, Minmus, Myhsf, MYH-2B, Minimsc, MHC2B, MyHC-IIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Ccdc106
Name: coiled-coil domain containing 106
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232821
Homologene: 81845
Nnt
Name: nicotinamide nucleotide transhydrogenase
Synonyms: 4930423F13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18115
HGNC: HGNC:7863
Ago4
Name: argonaute RISC catalytic subunit 4
Synonyms: 5730550L01Rik, argonaute 4, Eif2c4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76850
Homologene: 41184
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: Rgsl2, 4930415K13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240816
Homologene: 129962
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 28010
Homologene: 15879
Hif3a
Name: hypoxia inducible factor 3, alpha subunit
Synonyms: Nepas, MOP7, bHLHe17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53417
Homologene: 9646
Cnppd1
Name: cyclin Pas1/PHO80 domain containing 1
Synonyms: 1810031K17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69171
Homologene: 9238
Or51s1
Name: olfactory receptor family 51 subfamily S member 1
Synonyms: MOR21-1, GA_x6K02T2PBJ9-5620890-5619922, Olfr571
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259089
Homologene: 17498
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Gprc2a-rs3, Casr-rs3, EG637898
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Ssh3
Name: slingshot protein phosphatase 3
Synonyms: SSH-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 245857
VEGA: 19
Homologene: 32372
Cma2
Name: chymase 2, mast cell
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545055
VEGA: 14
Homologene: 115745
Lrrc14b
Name: leucine rich repeat containing 14B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432779
Homologene: 47758
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: Cklfsf1, CKLFH1, CHLFH1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Rdh8
Name: retinol dehydrogenase 8
Synonyms: prRDH, LOC235033
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235033
VEGA: 9
Homologene: 41062
Cisd3
Name: CDGSH iron sulfur domain 3
Synonyms: Mel13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217149
Homologene: 35399
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,136,419 bp
  • A to G, chromosome 1 at 106,782,684 bp
  • G to A, chromosome 1 at 153,821,354 bp
  • A to T, chromosome 1 at 170,852,966 bp
  • A to G, chromosome 2 at 6,560,657 bp
  • A to T, chromosome 3 at 38,892,120 bp
  • G to A, chromosome 3 at 40,672,732 bp
  • A to G, chromosome 3 at 97,570,369 bp
  • T to A, chromosome 4 at 125,086,197 bp
  • A to T, chromosome 4 at 126,493,250 bp
  • T to A, chromosome 4 at 147,866,382 bp
  • T to C, chromosome 5 at 104,093,352 bp
  • A to G, chromosome 6 at 143,083,220 bp
  • A to G, chromosome 7 at 5,059,571 bp
  • A to T, chromosome 7 at 17,040,987 bp
  • T to A, chromosome 7 at 42,142,230 bp
  • A to T, chromosome 7 at 80,494,528 bp
  • A to T, chromosome 7 at 85,872,941 bp
  • A to G, chromosome 7 at 102,909,129 bp
  • A to G, chromosome 8 at 70,388,155 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to T, chromosome 8 at 109,562,729 bp
  • A to C, chromosome 9 at 20,822,725 bp
  • A to T, chromosome 9 at 25,252,684 bp
  • C to T, chromosome 10 at 58,408,103 bp
  • T to A, chromosome 11 at 50,815,192 bp
  • C to T, chromosome 11 at 58,684,140 bp
  • C to T, chromosome 11 at 59,007,614 bp
  • T to A, chromosome 11 at 67,241,509 bp
  • T to A, chromosome 11 at 97,685,877 bp
  • T to C, chromosome 11 at 115,590,418 bp
  • T to G, chromosome 12 at 71,184,423 bp
  • T to A, chromosome 12 at 76,888,052 bp
  • T to A, chromosome 13 at 74,361,289 bp
  • T to C, chromosome 13 at 119,339,871 bp
  • T to C, chromosome 14 at 12,213,685 bp
  • A to G, chromosome 14 at 52,018,846 bp
  • A to G, chromosome 14 at 52,075,335 bp
  • G to T, chromosome 14 at 55,973,117 bp
  • A to T, chromosome 14 at 122,476,118 bp
  • T to C, chromosome 15 at 8,130,156 bp
  • T to G, chromosome 15 at 89,573,854 bp
  • A to T, chromosome 19 at 4,267,964 bp
  • A to G, chromosome 19 at 44,087,968 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8860 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068678-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.