MMRRC:068876-MU

G to A, chromosome 1 at 87,503,288 bp
A to T, chromosome 1 at 155,862,941 bp
A to G, chromosome 1 at 162,807,530 bp
A to T, chromosome 2 at 10,064,238 bp
A to T, chromosome 2 at 30,111,282 bp
C to T, chromosome 2 at 52,189,889 bp
A to T, chromosome 2 at 120,806,838 bp
G to A, chromosome 2 at 121,173,598 bp
A to G, chromosome 3 at 7,604,110 bp
CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
T to C, chromosome 3 at 123,350,725 bp
C to T, chromosome 3 at 146,438,757 bp
C to A, chromosome 4 at 43,549,786 bp
A to G, chromosome 4 at 46,798,659 bp
A to T, chromosome 4 at 143,726,759 bp
G to C, chromosome 5 at 33,983,530 bp
G to C, chromosome 6 at 129,419,598 bp
A to G, chromosome 7 at 4,742,282 bp
A to G, chromosome 7 at 14,332,945 bp
T to C, chromosome 7 at 46,773,183 bp
A to C, chromosome 7 at 108,171,880 bp
A to G, chromosome 7 at 113,385,836 bp
T to C, chromosome 8 at 33,342,993 bp
T to C, chromosome 8 at 85,110,705 bp
T to C, chromosome 8 at 94,390,826 bp
C to T, chromosome 9 at 20,786,395 bp
A to G, chromosome 9 at 46,233,294 bp
T to C, chromosome 9 at 122,379,540 bp
A to T, chromosome 10 at 103,416,655 bp
T to C, chromosome 11 at 49,328,103 bp
A to G, chromosome 11 at 50,357,790 bp
T to C, chromosome 11 at 61,344,334 bp
A to G, chromosome 11 at 68,991,741 bp
C to T, chromosome 11 at 80,022,197 bp
G to A, chromosome 11 at 82,988,294 bp
A to G, chromosome 11 at 94,044,468 bp
A to T, chromosome 12 at 101,958,128 bp
A to G, chromosome 12 at 102,369,479 bp
T to C, chromosome 13 at 12,216,862 bp
A to G, chromosome 13 at 21,702,980 bp
A to G, chromosome 13 at 54,735,320 bp
T to A, chromosome 14 at 55,721,599 bp
G to T, chromosome 15 at 99,212,129 bp
G to A, chromosome 15 at 101,008,280 bp
A to G, chromosome 15 at 102,709,965 bp
A to C, chromosome 16 at 84,734,956 bp
A to T, chromosome 17 at 24,185,924 bp
C to A, chromosome 17 at 24,185,925 bp
G to A, chromosome 17 at 30,918,918 bp
A to G, chromosome 17 at 37,279,929 bp
T to C, chromosome 17 at 71,700,883 bp
A to G, chromosome 17 at 84,429,201 bp
A to G, chromosome 17 at 88,636,800 bp
T to G, chromosome 18 at 37,487,233 bp
T to A, chromosome 19 at 18,641,175 bp
T to C, chromosome 19 at 45,767,915 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R9050 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
068876-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All