Strain Name:
C57BL/6J-MtgxR2001Btlr/Mmmh
Stock Number:
040011-MU
Citation ID:
RRID:MMRRC_040011-MU
Other Names:
R2001 (G1), C57BL/6J-MtgxR2001Btlr
Major Collection:

Gene Information

Sulf2
Name: sulfatase 2
Synonyms: 2010004N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 72043
Homologene: 10313
Adamts20
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223838
Homologene: 11808
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 666279
HGNC: HGNC:3054
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269275
Homologene: 26724
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: Glur2, Glur-2, GluR2, GluA2, GluR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11287
Homologene: 104112
Asna1
Name: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Synonyms: ArsA, 1810048H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 56495
HGNC: HGNC:752
Homologene: 31513
Dst
Name: dystonin
Synonyms: A830042E19Rik, 2310001O04Rik, Macf2, bullous pemphigoid antigen 1, BPAG1-n, BPAG1, athetoid, Bpag, ah, bullous pemphigoid antigen 1, Bpag1, nmf339, nmf203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 83921
VEGA: 19
Homologene: 75008
Dnmbp
Name: dynamin binding protein
Synonyms: Tuba, 2410003M15Rik, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 71972
Homologene: 9061
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: D130075K09Rik, 5430402I23Rik, LEC3, lectomedin 3, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319387
Homologene: 22878
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Pard3
Name: par-3 family cell polarity regulator
Synonyms: Pard3a, PAR-3, Par3, ASIP, D8Ertd580e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 93742
Homologene: 10489
Dhx9
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonyms: NDHII, NDH II, RHA, RNA helicase, nuclear DNA helicase II, leukophysin, Ddx9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 1810044A24Rik, 4632408O18Rik, Nibp, 2900005P22Rik, TRS130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 76510
VEGA: 15
Homologene: 81931
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Sel1l
Name: sel-1 suppressor of lin-12-like (C. elegans)
Synonyms: Sel1h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20338
Homologene: 31286
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 4921511H13Rik, 5730405K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 207932
Homologene: 45941
Ddx6
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Synonyms: p54, E230023J21Rik, HLR2, mRCK/P54, 1110001P04Rik, C430015D01Rik, rck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 13209
VEGA: 9
HGNC: HGNC:2747
Homologene: 3238
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 64898
Homologene: 8769
Ttc37
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218343
VEGA: 13
Homologene: 40966
Lck
Name: lymphocyte protein tyrosine kinase
Synonyms: Hck-3, p56lck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 16818
HGNC: HGNC:6524
Homologene: 3911
Ctnnd1
Name: catenin (cadherin associated protein), delta 1
Synonyms: P120, Ctnnd, Catns, p120-catenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12388
HGNC: HGNC:2515
Homologene: 1017
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: C330027C09Rik, Cip2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224171
Homologene: 10842
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105522
VEGA: 14
Homologene: 35374
Kif23
Name: kinesin family member 23
Synonyms: CHO1, MKLP-1, MKLP1, 3110001D19Rik, Knsl5, C87313
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71819
VEGA: 9
HGNC: HGNC:6392
Homologene: 11491
Noct
Name: nocturnin
Synonyms: Ccr4, Ccrn4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12457
Homologene: 7661
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Doc4, ELM2, l7Rn3, Odz4, Ten-m4, l(7)-3Rn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 23966
Homologene: 8034
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: 5830445G22Rik, Whsc1, D030027O06Rik, Whsc1l, D930023B08Rik, 9430010A17Rik, C130020C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 107823
Homologene: 26175
Leng8
Name: leukocyte receptor cluster (LRC) member 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232798
Homologene: 13612
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 74369
Homologene: 46535
Magel2
Name: melanoma antigen, family L, 2
Synonyms: Mage-l2, NDNL1, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Lcn6
Name: lipocalin 6
Synonyms: 9230101D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 620709
Homologene: 45707
Lrrc4
Name: leucine rich repeat containing 4
Synonyms: NGL-2, NGL2, Nag14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 192198
Homologene: 36403
Smad5
Name: SMAD family member 5
Synonyms: Smad 5, MusMLP, Madh5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17129
HGNC: HGNC:6771
Homologene: 4313
Asph
Name: aspartate-beta-hydroxylase
Synonyms: Junctin, cI-37, junctate, calsequestrin-binding protein, aspartyl beta-hydroxylase, 3110001L23Rik, jumbug, 2310005F16Rik, BAH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Impad1
Name: inositol monophosphatase domain containing 1
Synonyms: 1110001C20Rik, Jaws, gPAPP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242291
Homologene: 9852
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71409
Homologene: 70871
Ppp1r21
Name: protein phosphatase 1, regulatory subunit 21
Synonyms: Ccdc128, 1110018J12Rik, Klraq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 73825
Homologene: 44811
Pask
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269224
Homologene: 9038
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Dhx37
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 37
Synonyms: LOC208144, LOC381671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 208144
Homologene: 6641
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: 5730402G09Rik, 2310001G17Rik, Ccp1, 4930445M19Rik, 2900054O13Rik, Nna1, 1700020N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 67269
Homologene: 9067
Chkb
Name: choline kinase beta
Synonyms: Chkl, CK/EK-beta, Chetk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12651
HGNC: HGNC:1938
Homologene: 88718
Syk
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20963
Homologene: 2390
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: SkM1, mH2, Nav1.4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 110880
Homologene: 283
Sohlh2
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74434
Homologene: 9864
Adamts13
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
Synonyms: vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268379
Homologene: 27991
Elane
Name: elastase, neutrophil expressed
Synonyms: F430011M15Rik, NE, Ela2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 50701
VEGA: 10
HGNC: HGNC:3309
Homologene: 20455
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545370
Homologene: 23741
Ptprd
Name: protein tyrosine phosphatase, receptor type, D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 19266
HGNC: HGNC:9668
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Birc1b, Naip-rs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, 1500037O19Rik, D9Ertd414e, Unc13h3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 208898
Homologene: 45443
Bpifb5
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228802
Homologene: 64814
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Pak7
Name: p21 (RAC1) activated kinase 7
Synonyms: 2900083L08Rik, Pak5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241656
Homologene: 22211
Olfr800
Name: olfactory receptor 800
Synonyms: MOR114-7, GA_x6K02T2PULF-11338429-11339364
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258541
Homologene: 27203
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Birc1f, Naip-rs4, Naip-rs4A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: X83337, 1810073P09Rik, ESTM15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 75607
Homologene: 19155
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 4930518F03Rik, 3830402K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 320558
Homologene: 8604
Gbe1
Name: glucan (1,4-alpha-), branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 268780
Homologene: 65044
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 81877
Homologene: 49589
Ccdc121
Name: coiled-coil domain containing 121
Synonyms: LOC329308, 6530421E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 403180
Homologene: 136217
Dcaf12
Name: DDB1 and CUL4 associated factor 12
Synonyms: 5830424K06Rik, Wdr40a, 1500001L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 68970
Homologene: 49418
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 279029
Homologene: 19586
Olfr389
Name: olfactory receptor 389
Synonyms: MOR135-6, GA_x6K02T2P1NL-3932085-3931147
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 259011
Homologene: 85925
Slc38a7
Name: solute carrier family 38, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234595
Homologene: 41237
Lingo4
Name: leucine rich repeat and Ig domain containing 4
Synonyms: A530050P17Rik, Lrrn6d, LERN4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 320747
Homologene: 18563
Hhipl1
Name: hedgehog interacting protein-like 1
Synonyms: 1600002O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 214305
VEGA: 12
Homologene: 81985
Tex10
Name: testis expressed gene 10
Synonyms: 2810462N03Rik, clone 18330, 2610206N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 269536
Homologene: 32361
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Ccl20
Name: chemokine (C-C motif) ligand 20
Synonyms: CKb4, MIP-3[a], MIP3A, Scya20, ST38, exodus-1, MIP-3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20297
Homologene: 3375
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227058
Homologene: 41287
Tmprss11f
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243083
Homologene: 65356
Sqor
Name: sulfide quinone oxidoreductase
Synonyms: 0610039J17Rik, Sqrdl, 4930557M22Rik, flavo-binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 59010
Homologene: 10921
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 208177
Homologene: 17100
Npbwr1
Name: neuropeptides B/W receptor 1
Synonyms: Gpr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226304
HGNC: HGNC:4522
Homologene: 21096
Fam209
Name: family with sequence similarity 209
Synonyms: 1700029J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76426
Homologene: 19218
Ctla2b
Name: cytotoxic T lymphocyte-associated protein 2 beta
Synonyms: Ctla-2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 13025
VEGA: 13
Homologene: 130627
Abcc3
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms: MRP3, 1700019L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Gfra1
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 14585
HGNC: HGNC:4243
Homologene: 3855
Gm14139
Name: predicted gene 14139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 100271882
Homologene: 134546
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243547
Homologene: 16327
Itga2b
Name: integrin alpha 2b
Synonyms: GP IIb, CD41, platelet glycoprotein IIb, GpIIb, alphaIIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, SKIP, 4930544G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 77629
Homologene: 18172
Zfp598
Name: zinc finger protein 598
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 213753
VEGA: 17
Homologene: 5672
Tas2r122
Name: taste receptor, type 2, member 122
Synonyms: mGR22, T2R22, Tas2r22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 630845
Homologene: 105455
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 75721
Homologene: 138468
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, Cyln2, WSCR4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 64929
VEGA: 14
Homologene: 2850
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228005
Homologene: 3520
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Olfr1066
Name: olfactory receptor 1066
Synonyms: MOR188-8, GA_x6K02T2Q125-47925557-47924616, MOR256-52P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 257880
Homologene: 79468
Pde4c
Name: phosphodiesterase 4C, cAMP specific
Synonyms: E130301F19Rik, Dpde1, dunce
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 110385
HGNC: HGNC:8782
Homologene: 20256
Slc34a3
Name: solute carrier family 34 (sodium phosphate), member 3
Synonyms: NPTIIc, Npt2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 142681
Homologene: 15444
Olfr1020
Name: olfactory receptor 1020
Synonyms: MOR201-2, GA_x6K02T2Q125-47327964-47328917
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258573
Homologene: 45007
Upb1
Name: ureidopropionase, beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103149
Homologene: 9471
Tm2d2
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 69742
Homologene: 12328
Zfp945
Name: zinc finger protein 945
Synonyms: A630033E08Rik, C730040L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240041
Homologene: 133214
Naga
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 17939
VEGA: 15
HGNC: HGNC:7631
Homologene: 221
BC051019
Name: cDNA sequence BC051019
Synonyms: ICRFP703N2430Q5.5, D7H11orf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57355
HGNC: HGNC:1169
Homologene: 49631
Cd300ld
Name: CD300 molecule like family member d
Synonyms: Cd300ld1, MAIR-IV, Clm5, 4732429D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217305
Homologene: 129719
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: 1700003B17Rik, p130, 4732493F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226407
Homologene: 45617
Sgms1
Name: sphingomyelin synthase 1
Synonyms: SMS1alpha2, 9530058O11Rik, SMS1, Tmem23, SMS1beta, SMS1alpha1, SMS1gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 208449
Homologene: 27040
Pde6h
Name: phosphodiesterase 6H, cGMP-specific, cone, gamma
Synonyms: A930033D18Rik, PDEgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 78600
HGNC: HGNC:8790
Homologene: 4522
Slfnl1
Name: schlafen like 1
Synonyms: 4933406A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 194219
Homologene: 44913
Tmem95
Name: transmembrane protein 95
Synonyms: 432576
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 100503361
VEGA: 11
Homologene: 77849
Tex261
Name: testis expressed gene 261
Synonyms: TEG-261, 3110001O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 21766
Homologene: 6131
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233005
Homologene: 69128
A430005L14Rik
Name: RIKEN cDNA A430005L14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 97159
Homologene: 18433
AC124409.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
Rasgef1a
Name: RasGEF domain family, member 1A
Synonyms: 6330404M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 70727
Homologene: 17067
Zfp551
Name: zinc fingr protein 551
Synonyms: 9630004E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 619331
Homologene: 64631
Ccl6
Name: chemokine (C-C motif) ligand 6
Synonyms: MRP-1, Scya6, c10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20305
Homologene: 22507
Gm14189
Name: predicted gene 14189
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
Cdk2ap2
Name: CDK2-associated protein 2
Synonyms: 5830466O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 52004
Homologene: 4272
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 5,917,175 bp
  • A to T, chromosome 1 at 34,184,063 bp
  • T to C, chromosome 1 at 46,142,087 bp
  • ATT to ATTT, chromosome 1 at 83,117,855 bp
  • A to T, chromosome 1 at 83,276,662 bp
  • A to G, chromosome 1 at 93,325,545 bp
  • A to G, chromosome 1 at 127,903,719 bp
  • T to A, chromosome 1 at 150,738,613 bp
  • A to T, chromosome 1 at 153,456,111 bp
  • A to G, chromosome 1 at 158,520,521 bp
  • G to T, chromosome 1 at 181,510,986 bp
  • C to T, chromosome 2 at 25,230,973 bp
  • T to C, chromosome 2 at 25,681,162 bp
  • T to C, chromosome 2 at 26,952,747 bp
  • C to T, chromosome 2 at 26,973,990 bp
  • T to C, chromosome 2 at 53,118,267 bp
  • T to A, chromosome 2 at 58,315,975 bp
  • T to C, chromosome 2 at 68,741,456 bp
  • T to C, chromosome 2 at 69,741,644 bp
  • T to C, chromosome 2 at 84,620,360 bp
  • T to A, chromosome 2 at 85,850,400 bp
  • T to C, chromosome 2 at 86,455,473 bp
  • A to C, chromosome 2 at 122,798,098 bp
  • T to A, chromosome 2 at 136,116,637 bp
  • T to A, chromosome 2 at 150,192,947 bp
  • A to G, chromosome 2 at 154,233,279 bp
  • T to A, chromosome 2 at 166,080,853 bp
  • C to A, chromosome 2 at 172,472,769 bp
  • A to G, chromosome 2 at 173,153,925 bp
  • T to A, chromosome 2 at 178,378,055 bp
  • C to T, chromosome 3 at 51,248,044 bp
  • T to C, chromosome 3 at 55,192,341 bp
  • T to C, chromosome 3 at 80,710,805 bp
  • T to A, chromosome 3 at 94,403,075 bp
  • A to G, chromosome 3 at 114,165,293 bp
  • A to G, chromosome 4 at 4,776,301 bp
  • T to C, chromosome 4 at 9,514,583 bp
  • A to C, chromosome 4 at 41,302,804 bp
  • A to G, chromosome 4 at 48,451,940 bp
  • T to C, chromosome 4 at 75,954,122 bp
  • T to C, chromosome 4 at 120,533,227 bp
  • T to C, chromosome 4 at 126,454,394 bp
  • T to C, chromosome 4 at 129,548,937 bp
  • T to A, chromosome 4 at 153,959,857 bp
  • A to G, chromosome 5 at 33,843,402 bp
  • A to G, chromosome 5 at 81,757,973 bp
  • A to T, chromosome 5 at 86,539,768 bp
  • T to A, chromosome 5 at 104,178,559 bp
  • G to T, chromosome 5 at 125,427,464 bp
  • A to T, chromosome 5 at 134,494,205 bp
  • A to G, chromosome 6 at 28,830,905 bp
  • T to C, chromosome 6 at 36,865,801 bp
  • G to T, chromosome 6 at 83,773,731 bp
  • A to T, chromosome 6 at 91,779,850 bp
  • G to A, chromosome 6 at 118,089,196 bp
  • T to C, chromosome 6 at 128,516,120 bp
  • T to A, chromosome 6 at 132,711,622 bp
  • T to A, chromosome 6 at 136,963,205 bp
  • A to G, chromosome 7 at 4,145,074 bp
  • A to T, chromosome 7 at 12,416,349 bp
  • G to A, chromosome 7 at 26,934,772 bp
  • G to A, chromosome 7 at 62,379,096 bp
  • C to T, chromosome 7 at 96,811,994 bp
  • G to A, chromosome 7 at 109,720,551 bp
  • T to C, chromosome 8 at 25,017,507 bp
  • A to G, chromosome 8 at 70,747,358 bp
  • T to C, chromosome 8 at 85,025,160 bp
  • A to G, chromosome 8 at 95,845,001 bp
  • C to T, chromosome 8 at 110,111,376 bp
  • C to T, chromosome 8 at 127,064,347 bp
  • A to G, chromosome 9 at 44,607,534 bp
  • A to T, chromosome 9 at 61,927,384 bp
  • T to A, chromosome 9 at 73,483,615 bp
  • A to T, chromosome 10 at 75,429,969 bp
  • T to C, chromosome 10 at 79,887,759 bp
  • A to G, chromosome 10 at 91,061,814 bp
  • T to A, chromosome 10 at 129,660,421 bp
  • A to T, chromosome 11 at 9,273,967 bp
  • A to G, chromosome 11 at 69,876,991 bp
  • T to A, chromosome 11 at 73,776,713 bp
  • G to T, chromosome 11 at 83,589,337 bp
  • G to T, chromosome 11 at 94,364,344 bp
  • T to C, chromosome 11 at 99,674,159 bp
  • C to A, chromosome 11 at 102,467,339 bp
  • T to C, chromosome 11 at 106,329,988 bp
  • A to T, chromosome 11 at 114,987,330 bp
  • A to T, chromosome 12 at 91,826,550 bp
  • A to T, chromosome 12 at 108,321,859 bp
  • G to A, chromosome 13 at 49,078,682 bp
  • A to G, chromosome 13 at 52,611,238 bp
  • A to G, chromosome 13 at 56,737,374 bp
  • TGAAGATGCATCTTGAGAAGA to TGAAGA, chromosome 13 at 59,475,803 bp
  • T to C, chromosome 13 at 60,896,067 bp
  • T to A, chromosome 13 at 76,126,951 bp
  • A to T, chromosome 13 at 100,144,588 bp
  • C to T, chromosome 13 at 100,300,729 bp
  • A to T, chromosome 14 at 31,745,336 bp
  • A to T, chromosome 14 at 103,610,790 bp
  • T to A, chromosome 15 at 7,242,567 bp
  • A to G, chromosome 15 at 73,058,036 bp
  • T to A, chromosome 15 at 82,095,934 bp
  • G to T, chromosome 15 at 82,337,534 bp
  • C to T, chromosome 15 at 89,428,766 bp
  • T to C, chromosome 15 at 94,347,718 bp
  • C to A, chromosome 16 at 34,028,045 bp
  • T to C, chromosome 16 at 45,774,195 bp
  • T to C, chromosome 16 at 49,005,851 bp
  • A to G, chromosome 16 at 70,528,926 bp
  • T to C, chromosome 16 at 90,762,344 bp
  • C to T, chromosome 17 at 22,857,249 bp
  • T to C, chromosome 17 at 24,669,924 bp
  • G to A, chromosome 17 at 34,692,579 bp
  • A to G, chromosome 17 at 71,242,615 bp
  • T to C, chromosome 17 at 88,580,426 bp
  • A to G, chromosome 19 at 4,097,903 bp
  • A to G, chromosome 19 at 21,801,987 bp
  • A to G, chromosome 19 at 32,159,683 bp
  • G to C, chromosome 19 at 43,850,173 bp
  • A to G, chromosome 19 at 58,300,275 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2001 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040011-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.