Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2001Btlr/Mmmh
Stock Number:
040011-MU
Citation ID:
RRID:MMRRC_040011-MU
Other Names:
R2001 (G1), C57BL/6J-MtgxR2001Btlr
Major Collection:

Strain Information

Sulf2
Name: sulfatase 2
Synonyms: 2010004N24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72043
Homologene: 10313
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269275
Homologene: 26724
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Get3
Name: guided entry of tail-anchored proteins factor 3, ATPase
Synonyms: ArsA, 1810048H22Rik, Asna1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56495
HGNC: HGNC:752
Homologene: 31513
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 5,917,175 bp
  • A to T, chromosome 1 at 34,184,063 bp
  • T to C, chromosome 1 at 46,142,087 bp
  • ATT to ATTT, chromosome 1 at 83,117,855 bp
  • A to T, chromosome 1 at 83,276,662 bp
  • A to G, chromosome 1 at 93,325,545 bp
  • A to G, chromosome 1 at 127,903,719 bp
  • T to A, chromosome 1 at 150,738,613 bp
  • A to T, chromosome 1 at 153,456,111 bp
  • A to G, chromosome 1 at 158,520,521 bp
  • G to T, chromosome 1 at 181,510,986 bp
  • C to T, chromosome 2 at 25,230,973 bp
  • T to C, chromosome 2 at 25,681,162 bp
  • T to C, chromosome 2 at 26,952,747 bp
  • C to T, chromosome 2 at 26,973,990 bp
  • T to C, chromosome 2 at 53,118,267 bp
  • T to A, chromosome 2 at 58,315,975 bp
  • T to C, chromosome 2 at 68,741,456 bp
  • T to C, chromosome 2 at 69,741,644 bp
  • T to C, chromosome 2 at 84,620,360 bp
  • T to A, chromosome 2 at 85,850,400 bp
  • T to C, chromosome 2 at 86,455,473 bp
  • A to C, chromosome 2 at 122,798,098 bp
  • T to A, chromosome 2 at 136,116,637 bp
  • T to A, chromosome 2 at 150,192,947 bp
  • A to G, chromosome 2 at 154,233,279 bp
  • T to A, chromosome 2 at 166,080,853 bp
  • C to A, chromosome 2 at 172,472,769 bp
  • A to G, chromosome 2 at 173,153,925 bp
  • T to A, chromosome 2 at 178,378,055 bp
  • C to T, chromosome 3 at 51,248,044 bp
  • T to C, chromosome 3 at 55,192,341 bp
  • T to C, chromosome 3 at 80,710,805 bp
  • T to A, chromosome 3 at 94,403,075 bp
  • A to G, chromosome 3 at 114,165,293 bp
  • A to G, chromosome 4 at 4,776,301 bp
  • T to C, chromosome 4 at 9,514,583 bp
  • A to C, chromosome 4 at 41,302,804 bp
  • A to G, chromosome 4 at 48,451,940 bp
  • T to C, chromosome 4 at 75,954,122 bp
  • T to C, chromosome 4 at 120,533,227 bp
  • T to C, chromosome 4 at 126,454,394 bp
  • T to C, chromosome 4 at 129,548,937 bp
  • T to A, chromosome 4 at 153,959,857 bp
  • A to G, chromosome 5 at 33,843,402 bp
  • A to G, chromosome 5 at 81,757,973 bp
  • A to T, chromosome 5 at 86,539,768 bp
  • T to A, chromosome 5 at 104,178,559 bp
  • G to T, chromosome 5 at 125,427,464 bp
  • A to T, chromosome 5 at 134,494,205 bp
  • A to G, chromosome 6 at 28,830,905 bp
  • T to C, chromosome 6 at 36,865,801 bp
  • G to T, chromosome 6 at 83,773,731 bp
  • A to T, chromosome 6 at 91,779,850 bp
  • G to A, chromosome 6 at 118,089,196 bp
  • T to C, chromosome 6 at 128,516,120 bp
  • T to A, chromosome 6 at 132,711,622 bp
  • T to A, chromosome 6 at 136,963,205 bp
  • A to G, chromosome 7 at 4,145,074 bp
  • A to T, chromosome 7 at 12,416,349 bp
  • G to A, chromosome 7 at 26,934,772 bp
  • G to A, chromosome 7 at 62,379,096 bp
  • C to T, chromosome 7 at 96,811,994 bp
  • G to A, chromosome 7 at 109,720,551 bp
  • T to C, chromosome 8 at 25,017,507 bp
  • A to G, chromosome 8 at 70,747,358 bp
  • T to C, chromosome 8 at 85,025,160 bp
  • A to G, chromosome 8 at 95,845,001 bp
  • C to T, chromosome 8 at 110,111,376 bp
  • C to T, chromosome 8 at 127,064,347 bp
  • A to G, chromosome 9 at 44,607,534 bp
  • A to T, chromosome 9 at 61,927,384 bp
  • T to A, chromosome 9 at 73,483,615 bp
  • A to T, chromosome 10 at 75,429,969 bp
  • T to C, chromosome 10 at 79,887,759 bp
  • A to G, chromosome 10 at 91,061,814 bp
  • T to A, chromosome 10 at 129,660,421 bp
  • A to T, chromosome 11 at 9,273,967 bp
  • A to G, chromosome 11 at 69,876,991 bp
  • T to A, chromosome 11 at 73,776,713 bp
  • G to T, chromosome 11 at 83,589,337 bp
  • G to T, chromosome 11 at 94,364,344 bp
  • T to C, chromosome 11 at 99,674,159 bp
  • C to A, chromosome 11 at 102,467,339 bp
  • T to C, chromosome 11 at 106,329,988 bp
  • A to T, chromosome 11 at 114,987,330 bp
  • A to T, chromosome 12 at 91,826,550 bp
  • A to T, chromosome 12 at 108,321,859 bp
  • G to A, chromosome 13 at 49,078,682 bp
  • A to G, chromosome 13 at 52,611,238 bp
  • A to G, chromosome 13 at 56,737,374 bp
  • TGAAGATGCATCTTGAGAAGA to TGAAGA, chromosome 13 at 59,475,803 bp
  • T to C, chromosome 13 at 60,896,067 bp
  • T to A, chromosome 13 at 76,126,951 bp
  • A to T, chromosome 13 at 100,144,588 bp
  • C to T, chromosome 13 at 100,300,729 bp
  • A to T, chromosome 14 at 31,745,336 bp
  • A to T, chromosome 14 at 103,610,790 bp
  • T to A, chromosome 15 at 7,242,567 bp
  • A to G, chromosome 15 at 73,058,036 bp
  • T to A, chromosome 15 at 82,095,934 bp
  • G to T, chromosome 15 at 82,337,534 bp
  • C to T, chromosome 15 at 89,428,766 bp
  • T to C, chromosome 15 at 94,347,718 bp
  • C to A, chromosome 16 at 34,028,045 bp
  • T to C, chromosome 16 at 45,774,195 bp
  • T to C, chromosome 16 at 49,005,851 bp
  • A to G, chromosome 16 at 70,528,926 bp
  • T to C, chromosome 16 at 90,762,344 bp
  • C to T, chromosome 17 at 22,857,249 bp
  • T to C, chromosome 17 at 24,669,924 bp
  • G to A, chromosome 17 at 34,692,579 bp
  • A to G, chromosome 17 at 71,242,615 bp
  • T to C, chromosome 17 at 88,580,426 bp
  • A to G, chromosome 19 at 4,097,903 bp
  • A to G, chromosome 19 at 21,801,987 bp
  • A to G, chromosome 19 at 32,159,683 bp
  • G to C, chromosome 19 at 43,850,173 bp
  • A to G, chromosome 19 at 58,300,275 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2001 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040011-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.