Strain Name:
Stock Number:
Citation ID:
Other Names:
R2001 (G1), C57BL/6J-MtgxR2001Btlr
Major Collection:

Gene Information

Name: sulfatase 2
Synonyms: 2010004N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72043
Homologene: 10313
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 666279
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269275
Homologene: 26724
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14800
Homologene: 20225
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11287
Homologene: 104112
Name: guided entry of tail-anchored proteins factor 3, ATPase
Synonyms: ArsA, 1810048H22Rik, Asna1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56495
Homologene: 31513
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
Homologene: 136716
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71972
Homologene: 9061
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319387
Homologene: 22878
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18534
Homologene: 1944
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13211
Homologene: 1039
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236511
Homologene: 81826
Name: sel-1 suppressor of lin-12-like (C. elegans)
Synonyms: Sel1h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20338
Homologene: 31286
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 207932
Homologene: 45941
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Synonyms: mRCK/P54, HLR2, E230023J21Rik, p54, rck, 1110001P04Rik, C430015D01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13209
Homologene: 3238
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11783
Homologene: 7626
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 64898
Homologene: 8769
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Name: lymphocyte protein tyrosine kinase
Synonyms: Hck-3, p56lck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16818
Homologene: 3911
Name: catenin (cadherin associated protein), delta 1
Synonyms: P120, Ctnnd, p120-catenin, Catns
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12388
Homologene: 1017
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224171
Homologene: 10842
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Name: kinesin family member 23
Synonyms: CHO1, 3110001D19Rik, MKLP-1, MKLP1, Knsl5, C87313
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71819
Homologene: 11491
Name: nocturnin
Synonyms: Ccr4, Ccrn4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12457
Homologene: 7661
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Name: nuclear receptor binding SET domain protein 2
Synonyms: 5830445G22Rik, 9430010A17Rik, Whsc1l, D030027O06Rik, C130020C13Rik, D930023B08Rik, Whsc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 107823
Homologene: 26175
Name: leukocyte receptor cluster (LRC) member 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232798
Homologene: 13612
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Name: MAGE family member L2
Synonyms: NDNL1, nM15, ns7, Mage-l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27385
Homologene: 8460
Name: lipocalin 6
Synonyms: 9230101D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 620709
Homologene: 45707
Name: leucine rich repeat containing 4
Synonyms: Nag14, NGL-2, NGL2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 192198
Homologene: 36403
Name: SMAD family member 5
Synonyms: Smad 5, MusMLP, Madh5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17129
Homologene: 4313
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65973
Homologene: 20910
Name: 3'(2'), 5'-bisphosphate nucleotidase 2
Synonyms: 1110001C20Rik, Jaws, gPAPP, Impad1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242291
Homologene: 9852
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71409
Homologene: 70871
Name: protein phosphatase 1, regulatory subunit 21
Synonyms: 1110018J12Rik, Ccdc128, Klraq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73825
Homologene: 44811
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269224
Homologene: 9038
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
Homologene: 57160
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 37
Synonyms: LOC208144, LOC381671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208144
Homologene: 6641
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67269
Homologene: 9067
Name: choline kinase beta
Synonyms: CK/EK-beta, Chetk, Chkl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12651
Homologene: 88718
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20963
Homologene: 2390
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: Nav1.4, mH2, SkM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 110880
Homologene: 283
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74434
Homologene: 9864
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 279028
Homologene: 16372
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Name: elastase, neutrophil expressed
Synonyms: NE, F430011M15Rik, Ela2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 50701
VEGA: 10
Homologene: 20455
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Name: protein tyrosine phosphatase, receptor type, D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19266
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17948
Homologene: 136092
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228802
Homologene: 64814
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11899
Homologene: 7233
Name: p21 (RAC1) activated kinase 5
Synonyms: Pak5, 2900083L08Rik, Pak7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241656
Homologene: 22211
Name: olfactory receptor 800
Synonyms: GA_x6K02T2PULF-11338429-11339364, MOR114-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258541
Homologene: 27203
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
Homologene: 113589
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75607
Homologene: 19155
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320558
Homologene: 8604
Name: glucan (1,4-alpha-), branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74185
Homologene: 129
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268780
Homologene: 65044
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81877
Homologene: 49589
Name: coiled-coil domain containing 121
Synonyms: LOC329308, 6530421E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 403180
Homologene: 136217
Name: DDB1 and CUL4 associated factor 12
Synonyms: 5830424K06Rik, 1500001L20Rik, Wdr40a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68970
Homologene: 49418
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 279029
Homologene: 19586
Name: olfactory receptor 389
Synonyms: GA_x6K02T2P1NL-3932085-3931147, MOR135-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259011
Homologene: 85925
Name: solute carrier family 38, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234595
Homologene: 41237
Name: leucine rich repeat and Ig domain containing 4
Synonyms: A530050P17Rik, Lrrn6d, LERN4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 320747
Homologene: 18563
Name: hedgehog interacting protein-like 1
Synonyms: 1600002O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214305
VEGA: 12
Homologene: 81985
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269536
Homologene: 32361
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12814
Homologene: 56389
Name: chemokine (C-C motif) ligand 20
Synonyms: MIP-3[a], ST38, MIP-3A, MIP3A, Scya20, CKb4, exodus-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20297
Homologene: 3375
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243083
Homologene: 65356
Name: sulfide quinone oxidoreductase
Synonyms: flavo-binding protein, 4930557M22Rik, 0610039J17Rik, Sqrdl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59010
Homologene: 10921
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208177
Homologene: 17100
Name: neuropeptides B/W receptor 1
Synonyms: Gpr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226304
Homologene: 21096
Name: family with sequence similarity 209
Synonyms: 1700029J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76426
Homologene: 19218
Name: cytotoxic T lymphocyte-associated protein 2 beta
Synonyms: Ctla-2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13025
VEGA: 13
Homologene: 130627
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76408
Homologene: 68364
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14585
Homologene: 3855
Name: predicted gene 14139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100271882
Homologene: 134546
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243547
Homologene: 16327
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GpIIb, alphaIIb, CD41, GP IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16399
Homologene: 37304
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77629
Homologene: 18172
Name: zinc finger protein 598
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Name: taste receptor, type 2, member 122
Synonyms: Tas2r22, mGR22, T2R22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 630845
Homologene: 105455
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75721
Homologene: 138468
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269713
Homologene: 20718
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228005
Homologene: 3520
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320127
Homologene: 37956
Name: olfactory receptor 1066
Synonyms: GA_x6K02T2Q125-47925557-47924616, MOR188-8, MOR256-52P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257880
Homologene: 79468
Name: phosphodiesterase 4C, cAMP specific
Synonyms: dunce, Dpde1, E130301F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 110385
Homologene: 20256
Name: solute carrier family 34 (sodium phosphate), member 3
Synonyms: NPTIIc, Npt2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 142681
Homologene: 15444
Name: olfactory receptor 1020
Synonyms: GA_x6K02T2Q125-47327964-47328917, MOR201-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258573
Homologene: 45007
Name: ureidopropionase, beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103149
Homologene: 9471
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69742
Homologene: 12328
Name: zinc finger protein 945
Synonyms: C730040L01Rik, A630033E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240041
Homologene: 133214
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17939
VEGA: 15
Homologene: 221
Name: cDNA sequence BC051019
Synonyms: D7H11orf16, ICRFP703N2430Q5.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57355
Homologene: 49631
Name: CD300 molecule like family member d
Synonyms: Clm5, MAIR-IV, 4732429D16Rik, Cd300ld1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217305
Homologene: 129719
Name: RAB3 GTPase activating protein subunit 1
Synonyms: 1700003B17Rik, 4732493F09Rik, p130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226407
Homologene: 45617
Name: sphingomyelin synthase 1
Synonyms: SMS1, 9530058O11Rik, SMS1gamma, SMS1beta, SMS1alpha2, SMS1alpha1, Tmem23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 208449
Homologene: 27040
Name: phosphodiesterase 6H, cGMP-specific, cone, gamma
Synonyms: PDEgamma, A930033D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78600
Homologene: 4522
Name: schlafen like 1
Synonyms: 4933406A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194219
Homologene: 44913
Name: transmembrane protein 95
Synonyms: 432576
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100503361
VEGA: 11
Homologene: 77849
Name: testis expressed gene 261
Synonyms: TEG-261, 3110001O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21766
Homologene: 6131
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233005
Homologene: 69128
Name: RIKEN cDNA A430005L14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 97159
Homologene: 18433
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Name: RasGEF domain family, member 1A
Synonyms: 6330404M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70727
Homologene: 17067
Name: zinc fingr protein 551
Synonyms: 9630004E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 619331
Homologene: 64631
Name: chemokine (C-C motif) ligand 6
Synonyms: c10, MRP-1, Scya6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20305
Homologene: 22507
Name: predicted gene 14189
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Name: CDK2-associated protein 2
Synonyms: 5830466O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52004
Homologene: 4272
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 5,917,175 bp
  • A to T, chromosome 1 at 34,184,063 bp
  • T to C, chromosome 1 at 46,142,087 bp
  • ATT to ATTT, chromosome 1 at 83,117,855 bp
  • A to T, chromosome 1 at 83,276,662 bp
  • A to G, chromosome 1 at 93,325,545 bp
  • A to G, chromosome 1 at 127,903,719 bp
  • T to A, chromosome 1 at 150,738,613 bp
  • A to T, chromosome 1 at 153,456,111 bp
  • A to G, chromosome 1 at 158,520,521 bp
  • G to T, chromosome 1 at 181,510,986 bp
  • C to T, chromosome 2 at 25,230,973 bp
  • T to C, chromosome 2 at 25,681,162 bp
  • T to C, chromosome 2 at 26,952,747 bp
  • C to T, chromosome 2 at 26,973,990 bp
  • T to C, chromosome 2 at 53,118,267 bp
  • T to A, chromosome 2 at 58,315,975 bp
  • T to C, chromosome 2 at 68,741,456 bp
  • T to C, chromosome 2 at 69,741,644 bp
  • T to C, chromosome 2 at 84,620,360 bp
  • T to A, chromosome 2 at 85,850,400 bp
  • T to C, chromosome 2 at 86,455,473 bp
  • A to C, chromosome 2 at 122,798,098 bp
  • T to A, chromosome 2 at 136,116,637 bp
  • T to A, chromosome 2 at 150,192,947 bp
  • A to G, chromosome 2 at 154,233,279 bp
  • T to A, chromosome 2 at 166,080,853 bp
  • C to A, chromosome 2 at 172,472,769 bp
  • A to G, chromosome 2 at 173,153,925 bp
  • T to A, chromosome 2 at 178,378,055 bp
  • C to T, chromosome 3 at 51,248,044 bp
  • T to C, chromosome 3 at 55,192,341 bp
  • T to C, chromosome 3 at 80,710,805 bp
  • T to A, chromosome 3 at 94,403,075 bp
  • A to G, chromosome 3 at 114,165,293 bp
  • A to G, chromosome 4 at 4,776,301 bp
  • T to C, chromosome 4 at 9,514,583 bp
  • A to C, chromosome 4 at 41,302,804 bp
  • A to G, chromosome 4 at 48,451,940 bp
  • T to C, chromosome 4 at 75,954,122 bp
  • T to C, chromosome 4 at 120,533,227 bp
  • T to C, chromosome 4 at 126,454,394 bp
  • T to C, chromosome 4 at 129,548,937 bp
  • T to A, chromosome 4 at 153,959,857 bp
  • A to G, chromosome 5 at 33,843,402 bp
  • A to G, chromosome 5 at 81,757,973 bp
  • A to T, chromosome 5 at 86,539,768 bp
  • T to A, chromosome 5 at 104,178,559 bp
  • G to T, chromosome 5 at 125,427,464 bp
  • A to T, chromosome 5 at 134,494,205 bp
  • A to G, chromosome 6 at 28,830,905 bp
  • T to C, chromosome 6 at 36,865,801 bp
  • G to T, chromosome 6 at 83,773,731 bp
  • A to T, chromosome 6 at 91,779,850 bp
  • G to A, chromosome 6 at 118,089,196 bp
  • T to C, chromosome 6 at 128,516,120 bp
  • T to A, chromosome 6 at 132,711,622 bp
  • T to A, chromosome 6 at 136,963,205 bp
  • A to G, chromosome 7 at 4,145,074 bp
  • A to T, chromosome 7 at 12,416,349 bp
  • G to A, chromosome 7 at 26,934,772 bp
  • G to A, chromosome 7 at 62,379,096 bp
  • C to T, chromosome 7 at 96,811,994 bp
  • G to A, chromosome 7 at 109,720,551 bp
  • T to C, chromosome 8 at 25,017,507 bp
  • A to G, chromosome 8 at 70,747,358 bp
  • T to C, chromosome 8 at 85,025,160 bp
  • A to G, chromosome 8 at 95,845,001 bp
  • C to T, chromosome 8 at 110,111,376 bp
  • C to T, chromosome 8 at 127,064,347 bp
  • A to G, chromosome 9 at 44,607,534 bp
  • A to T, chromosome 9 at 61,927,384 bp
  • T to A, chromosome 9 at 73,483,615 bp
  • A to T, chromosome 10 at 75,429,969 bp
  • T to C, chromosome 10 at 79,887,759 bp
  • A to G, chromosome 10 at 91,061,814 bp
  • T to A, chromosome 10 at 129,660,421 bp
  • A to T, chromosome 11 at 9,273,967 bp
  • A to G, chromosome 11 at 69,876,991 bp
  • T to A, chromosome 11 at 73,776,713 bp
  • G to T, chromosome 11 at 83,589,337 bp
  • G to T, chromosome 11 at 94,364,344 bp
  • T to C, chromosome 11 at 99,674,159 bp
  • C to A, chromosome 11 at 102,467,339 bp
  • T to C, chromosome 11 at 106,329,988 bp
  • A to T, chromosome 11 at 114,987,330 bp
  • A to T, chromosome 12 at 91,826,550 bp
  • A to T, chromosome 12 at 108,321,859 bp
  • G to A, chromosome 13 at 49,078,682 bp
  • A to G, chromosome 13 at 52,611,238 bp
  • A to G, chromosome 13 at 56,737,374 bp
  • TGAAGATGCATCTTGAGAAGA to TGAAGA, chromosome 13 at 59,475,803 bp
  • T to C, chromosome 13 at 60,896,067 bp
  • T to A, chromosome 13 at 76,126,951 bp
  • A to T, chromosome 13 at 100,144,588 bp
  • C to T, chromosome 13 at 100,300,729 bp
  • A to T, chromosome 14 at 31,745,336 bp
  • A to T, chromosome 14 at 103,610,790 bp
  • T to A, chromosome 15 at 7,242,567 bp
  • A to G, chromosome 15 at 73,058,036 bp
  • T to A, chromosome 15 at 82,095,934 bp
  • G to T, chromosome 15 at 82,337,534 bp
  • C to T, chromosome 15 at 89,428,766 bp
  • T to C, chromosome 15 at 94,347,718 bp
  • C to A, chromosome 16 at 34,028,045 bp
  • T to C, chromosome 16 at 45,774,195 bp
  • T to C, chromosome 16 at 49,005,851 bp
  • A to G, chromosome 16 at 70,528,926 bp
  • T to C, chromosome 16 at 90,762,344 bp
  • C to T, chromosome 17 at 22,857,249 bp
  • T to C, chromosome 17 at 24,669,924 bp
  • G to A, chromosome 17 at 34,692,579 bp
  • A to G, chromosome 17 at 71,242,615 bp
  • T to C, chromosome 17 at 88,580,426 bp
  • A to G, chromosome 19 at 4,097,903 bp
  • A to G, chromosome 19 at 21,801,987 bp
  • A to G, chromosome 19 at 32,159,683 bp
  • G to C, chromosome 19 at 43,850,173 bp
  • A to G, chromosome 19 at 58,300,275 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2001 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040011-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.