Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2049Btlr/Mmmh
Stock Number:
040056-MU
Citation ID:
RRID:MMRRC_040056-MU
Other Names:
R2049 (G1), C57BL/6J-MtgxR2049Btlr
Major Collection:

Strain Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Snx2
Name: sorting nexin 2
Synonyms: 0610030A03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67804
VEGA: 18
Homologene: 2332
Efnb1
Name: ephrin B1
Synonyms: Stra1, LERK-2, Cek5 ligand, Epl2, Cek5-L, EFL-3, Elk-L, Eplg2, Lerk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Pex7
Name: peroxisomal biogenesis factor 7
Synonyms: peroxisome biogenesis factor 7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18634
HGNC: HGNC:8860
Homologene: 242
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 22,596,435 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • T to A, chromosome 1 at 53,281,988 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • A to G, chromosome 1 at 93,137,315 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • T to A, chromosome 1 at 135,970,638 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • A to G, chromosome 1 at 136,487,080 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • A to G, chromosome 1 at 136,510,167 bp
  • GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC, chromosome 1 at 136,625,353 bp
  • AAAAT to AAAATCAAAT, chromosome 1 at 138,092,244 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • T to A, chromosome 2 at 75,858,926 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to C, chromosome 2 at 85,041,427 bp
  • A to T, chromosome 2 at 88,728,745 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to T, chromosome 2 at 161,534,545 bp
  • T to A, chromosome 3 at 70,018,836 bp
  • T to G, chromosome 3 at 83,942,788 bp
  • C to T, chromosome 4 at 41,379,257 bp
  • A to G, chromosome 4 at 98,820,296 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • T to A, chromosome 4 at 143,416,871 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • T to C, chromosome 4 at 152,121,257 bp
  • C to A, chromosome 5 at 25,285,079 bp
  • G to A, chromosome 5 at 92,181,936 bp
  • G to T, chromosome 5 at 129,115,095 bp
  • T to A, chromosome 6 at 18,225,914 bp
  • C to A, chromosome 6 at 48,460,763 bp
  • A to C, chromosome 6 at 48,463,531 bp
  • T to A, chromosome 6 at 48,977,755 bp
  • T to C, chromosome 6 at 57,431,958 bp
  • T to C, chromosome 6 at 66,553,561 bp
  • A to G, chromosome 6 at 83,772,259 bp
  • A to G, chromosome 6 at 85,444,318 bp
  • A to G, chromosome 7 at 45,553,798 bp
  • A to T, chromosome 7 at 105,389,839 bp
  • A to G, chromosome 7 at 119,656,039 bp
  • A to G, chromosome 7 at 126,768,594 bp
  • A to G, chromosome 7 at 135,670,695 bp
  • T to G, chromosome 8 at 15,106,379 bp
  • A to G, chromosome 8 at 108,945,177 bp
  • G to T, chromosome 8 at 123,892,064 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to T, chromosome 9 at 39,720,115 bp
  • T to A, chromosome 9 at 40,101,119 bp
  • A to G, chromosome 9 at 64,889,605 bp
  • G to A, chromosome 9 at 70,581,301 bp
  • A to G, chromosome 9 at 75,893,790 bp
  • C to T, chromosome 9 at 106,373,897 bp
  • T to A, chromosome 9 at 121,741,694 bp
  • T to C, chromosome 9 at 123,100,537 bp
  • T to A, chromosome 10 at 19,894,315 bp
  • T to C, chromosome 10 at 24,050,425 bp
  • T to A, chromosome 10 at 26,849,942 bp
  • T to A, chromosome 10 at 67,157,998 bp
  • G to A, chromosome 10 at 76,004,884 bp
  • A to G, chromosome 10 at 80,585,606 bp
  • A to T, chromosome 10 at 120,106,021 bp
  • A to T, chromosome 10 at 123,119,137 bp
  • A to G, chromosome 10 at 127,336,727 bp
  • A to G, chromosome 10 at 127,563,804 bp
  • A to G, chromosome 10 at 129,912,167 bp
  • A to G, chromosome 11 at 66,044,683 bp
  • A to G, chromosome 11 at 82,905,366 bp
  • G to T, chromosome 11 at 96,961,365 bp
  • A to G, chromosome 11 at 108,606,325 bp
  • T to C, chromosome 11 at 116,977,670 bp
  • A to T, chromosome 11 at 121,250,369 bp
  • A to G, chromosome 12 at 5,137,876 bp
  • A to G, chromosome 12 at 54,062,088 bp
  • A to G, chromosome 12 at 84,396,858 bp
  • A to G, chromosome 12 at 87,517,276 bp
  • T to A, chromosome 12 at 113,544,429 bp
  • T to A, chromosome 13 at 9,878,335 bp
  • T to A, chromosome 13 at 116,894,886 bp
  • A to T, chromosome 14 at 24,154,647 bp
  • G to A, chromosome 14 at 54,584,987 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • T to A, chromosome 15 at 44,547,513 bp
  • G to A, chromosome 15 at 44,581,741 bp
  • A to G, chromosome 15 at 75,657,675 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • G to A, chromosome 15 at 86,142,808 bp
  • T to A, chromosome 15 at 89,159,002 bp
  • C to A, chromosome 15 at 98,136,069 bp
  • G to A, chromosome 15 at 98,378,396 bp
  • A to G, chromosome 15 at 99,579,366 bp
  • T to A, chromosome 15 at 101,545,156 bp
  • G to A, chromosome 15 at 103,531,406 bp
  • T to C, chromosome 16 at 22,818,541 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • G to T, chromosome 16 at 97,950,155 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • A to G, chromosome 17 at 19,522,050 bp
  • A to G, chromosome 17 at 20,268,304 bp
  • T to C, chromosome 17 at 32,482,138 bp
  • T to C, chromosome 17 at 36,325,216 bp
  • A to T, chromosome 18 at 19,989,680 bp
  • A to T, chromosome 18 at 46,963,747 bp
  • G to A, chromosome 18 at 53,194,444 bp
  • G to T, chromosome 18 at 54,895,565 bp
  • A to G, chromosome 19 at 4,698,605 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • G to A, chromosome 19 at 10,439,213 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2049 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040056-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.