Strain Name:
C57BL/6J-MtgxR2049Btlr/Mmmh
Stock Number:
040056-MU
Citation ID:
RRID:MMRRC_040056-MU
Other Names:
R2049 (G1), C57BL/6J-MtgxR2049Btlr
Major Collection:

Gene Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: TAP, Vdp, transcytosis associated protein p115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56041
Homologene: 2754
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231051
Homologene: 46480
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp5, Zfp-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Snx2
Name: sorting nexin 2
Synonyms: 0610030A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 67804
VEGA: 18
Homologene: 2332
Efnb1
Name: ephrin B1
Synonyms: Lerk2, Elk-L, LERK-2, Stra1, Cek5 ligand, Cek5-L, Eplg2, Epl2, EFL-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11426
Homologene: 136191
Pex7
Name: peroxisomal biogenesis factor 7
Synonyms: peroxisome biogenesis factor 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 18634
HGNC: HGNC:8860
Homologene: 242
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 108829
Homologene: 3129
Ppp1r1a
Name: protein phosphatase 1, regulatory inhibitor subunit 1A
Synonyms: 0610038N18Rik, protein phosphatase inhibitor-1, inhibitor-1, I-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 58200
VEGA: 15
HGNC: HGNC:9286
Homologene: 4905
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Commd10
Name: COMM domain containing 10
Synonyms: 2310003A05Rik, DRWMS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 69456
VEGA: 18
Homologene: 9404
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, Sci, A230102L03Rik, Atbf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 117599
Homologene: 50463
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: E430033I05Rik, 4921514G19Rik, Gcap18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 14479
VEGA: 10
Homologene: 101542
Agps
Name: alkylglycerone phosphate synthase
Synonyms: 9930035G10Rik, ADAPS, bs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228061
HGNC: HGNC:327
Homologene: 2716
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: G22p1, Ku p70, Ku70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Ubap1
Name: ubiquitin-associated protein 1
Synonyms: 2700092A01Rik, NAG20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67123
Homologene: 9554
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, S-afadin, Mllt4, I-afadin, 5033403D15Rik, Afadin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730555F13Rik, 9130215G10Rik, 5730455C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66660
VEGA: 9
Homologene: 11696
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239250
VEGA: 14
Homologene: 12986
Smyd5
Name: SET and MYND domain containing 5
Synonyms: NN8-4AG, Rrg1, Rai15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232187
Homologene: 6143
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226432
Homologene: 5874
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: B430213I24Rik, Znf295, 5430437K12Rik, Zfp295
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 114565
VEGA: 16
Homologene: 10799
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Syt7
Name: synaptotagmin VII
Synonyms: B230112P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 54525
VEGA: 19
Homologene: 20889
Zfp281
Name: zinc finger protein 281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226442
Homologene: 8270
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf1, Cromer blood group, complement-glycosylphosphatidylinositol, GPI-DAF, Daf-GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: Lyt-4, CD45, Ly-5, T200, B220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Plxnb2
Name: plexin B2
Synonyms: 1110007H23Rik, Debt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Fam160a2
Name: family with sequence similarity 160, member A2
Synonyms: 6530415H11Rik, 4632419K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 74349
Homologene: 75329
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: p600, A930005E13Rik, 1810009A16Rik, LOC381562, D930005K06Rik, Zubr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 69116
Homologene: 10804
Sp2
Name: Sp2 transcription factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 78912
Homologene: 2340
Plec
Name: plectin
Synonyms: Plec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18810
HGNC: HGNC:9069
Homologene: 384
Gprasp1
Name: G protein-coupled receptor associated sorting protein 1
Synonyms: 2210415K24Rik, GASP1, 3110031O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 67298
Homologene: 8809
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20980
Homologene: 22516
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Cntrl
Name: centriolin
Synonyms: b2b1468Clo, 6720467O09Rik, IB3/5, Cep110, Cep1, Ma2a8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Nle1
Name: notchless homolog 1
Synonyms: l11Jus1, Nle, notchless, l11Jus4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217011
Homologene: 5494
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229473
Homologene: 9057
Gm8300
Name: predicted gene 8300
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 666806
Homologene: 103865
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268510
Homologene: 27821
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67196
Homologene: 40929
Adgrd1
Name: adhesion G protein-coupled receptor D1
Synonyms: Gpr133, E230012M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243277
Homologene: 34616
Tbccd1
Name: TBCC domain containing 1
Synonyms: 5730478M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 70573
VEGA: 16
Homologene: 32392
Acta1
Name: actin, alpha 1, skeletal muscle
Synonyms: Actsk-1, Acts
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11459
HGNC: HGNC:129
Homologene: 121702
Gdpd3
Name: glycerophosphodiester phosphodiesterase domain containing 3
Synonyms: 1110015E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 68616
Homologene: 23441
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: A2mr, b2b1554Clo, CD91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 269023
VEGA: 18
Homologene: 18485
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Dennd4a
Name: DENN/MADD domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 102442
VEGA: 9
Homologene: 55933
Olfr965
Name: olfactory receptor 965
Synonyms: MOR171-28, GA_x6K02T2PVTD-33416730-33417668
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258165
VEGA: 9
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627537
Homologene: 129750
Espn
Name: espin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56226
Homologene: 23164
Gm5134
Name: predicted gene 5134
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 333669
Homologene: 129891
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Entpd5
Name: ectonucleoside triphosphate diphosphohydrolase 5
Synonyms: mNTPase, NTPDase-5, Cd39l4, Pcph, ER-UDPase, NTPDase5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 12499
HGNC: HGNC:3367
Homologene: 37457
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 117147
Homologene: 24930
Asb8
Name: ankyrin repeat and SOCS box-containing 8
Synonyms: C430011H06Rik, 4930539L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 78541
Homologene: 32572
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1alpha, RIM1, C030033M19Rik, RIM1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116837
Homologene: 128399
Npas3
Name: neuronal PAS domain protein 3
Synonyms: 4930423H22Rik, bHLHe12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 27386
VEGA: 12
Homologene: 8461
Ctse
Name: cathepsin E
Synonyms: A430072O03Rik, C920004C08Rik, CE, CatE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Ptprt
Name: protein tyrosine phosphatase, receptor type, T
Synonyms: RPTPrho
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Myom2
Name: myomesin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Vmn1r20
Name: vomeronasal 1 receptor 20
Synonyms: Gm5569
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 434017
Homologene: 79462
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: 2410005C22Rik, PEPP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 69217
Homologene: 10848
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243369
Homologene: 45453
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Otol1
Name: otolin 1
Synonyms: Gm414, LOC229389
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229389
Homologene: 19018
Taar7f
Name: trace amine-associated receptor 7F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 435207
Homologene: 134040
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 381204
Homologene: 21124
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381293
Homologene: 8916
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227058
Homologene: 41287
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Narf
Name: nuclear prelamin A recognition factor
Synonyms: 4430402O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 67608
Homologene: 57048
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226438
Homologene: 130054
Cyp4f39
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 320997
VEGA: 17
Homologene: 69814
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: muscarinic acetylcholine receptor 3, M3R, Chrm-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Ptpre
Name: protein tyrosine phosphatase, receptor type, E
Synonyms: PTPepsilon, RPTPepsilon, PTPe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Bscl2
Name: Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 14705
Homologene: 32032
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319901
Homologene: 12964
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17858
Ren1
Name: renin 1 structural
Synonyms: Ren-A, Ren-1, Ren, Ren1c, Rnr, Ren1d, Rn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 636808
Homologene: 43974
Doxl2
Name: diamine oxidase-like protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243376
Homologene: 19443
Ssrp1
Name: structure specific recognition protein 1
Synonyms: Hmgox, Hmgi-rs3, T160, Hmg1-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20833
Homologene: 110735
Cerk
Name: ceramide kinase
Synonyms: D330016D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223753
Homologene: 11247
Olfr1197
Name: olfactory receptor 1197
Synonyms: MOR225-10P, MOR225-14, GA_x6K02T2Q125-50202854-50201910
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 433449
Homologene: 123770
Klhl29
Name: kelch-like 29
Synonyms: A230106N14Rik, Kbtbd9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 208439
VEGA: 12
Homologene: 66272
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: D13Ertd275e, 2810430O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 52552
VEGA: 13
Homologene: 11621
Olfr1240
Name: olfactory receptor 1240
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258804
Homologene: 121591
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, A530054J02Rik, Ssa, Trove2, 1810007I17Rik, Ssa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20822
Homologene: 3383
Olfr816
Name: olfactory receptor 816
Synonyms: GA_x6K02T2PULF-11590830-11589892, MOR113-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258667
Homologene: 133584
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224576
Homologene: 135824
Gm960
Name: predicted gene 960
Synonyms: Top6bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 381196
VEGA: 19
Homologene: 69381
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20668
Homologene: 4159
4931414P19Rik
Name: RIKEN cDNA 4931414P19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 74359
VEGA: 14
Homologene: 11078
Kat5
Name: K(lysine) acetyltransferase 5
Synonyms: PLIP, Htatip, mHTATIP/CPLA2, Tip60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 81601
VEGA: 19
HGNC: HGNC:5275
Homologene: 100661
Olfr984
Name: olfactory receptor 984
Synonyms: GA_x6K02T2PVTD-33799484-33798540, MOR239-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258601
VEGA: 9
Homologene: 17314
Pramef8
Name: PRAME family member 8
Synonyms: 4732496O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242736
Homologene: 128393
Vmn1r32
Name: vomeronasal 1 receptor 32
Synonyms: V1rc15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 171188
Homologene: 115644
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 73910
Homologene: 14135
Cep112
Name: centrosomal protein 112
Synonyms: 1700029K01Rik, 8430407H02Rik, Macoco, 1700001M19Rik, Ccdc46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76380
Homologene: 44915
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cardiac TnT, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21956
Homologene: 68050
Zdhhc3
Name: zinc finger, DHHC domain containing 3
Synonyms: 1110020O22Rik, Zfp373, 2210017C02Rik, GODZ, 1810006O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 69035
Homologene: 9582
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 194231
Homologene: 4604
Gm4907
Name: predicted gene 4907
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 236749
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Agxt
Name: alanine-glyoxylate aminotransferase
Synonyms: Agxt1, Agt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11611
HGNC: HGNC:341
Homologene: 37251
Dusp7
Name: dual specificity phosphatase 7
Synonyms: MKP-X, PYST2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235584
HGNC: HGNC:3073
Homologene: 1468
Abhd17a
Name: abhydrolase domain containing 17A
Synonyms: D10Bwg1364e, Fam108a, 1700013O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216169
Homologene: 50272
Top1mt
Name: DNA topoisomerase 1, mitochondrial
Synonyms: 2900052H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72960
Homologene: 43082
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Aqp2
Name: aquaporin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 11827
VEGA: 15
HGNC: HGNC:634
Homologene: 20137
H2-M10.1
Name: histocompatibility 2, M region locus 10.1
Synonyms: 9.5H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14985
Homologene: 117973
Tex261
Name: testis expressed gene 261
Synonyms: TEG-261, 3110001O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 21766
Homologene: 6131
I0C0044D17Rik
Name: RIKEN cDNA I0C0044D17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 545660
Olfr283
Name: olfactory receptor 283
Synonyms: MOR160-1, GA_x6K02T2NBG7-5351896-5352825
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 259038
Homologene: 64944
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 22,596,435 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • T to A, chromosome 1 at 53,281,988 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • A to G, chromosome 1 at 93,137,315 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • T to A, chromosome 1 at 135,970,638 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • A to G, chromosome 1 at 136,487,080 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • A to G, chromosome 1 at 136,510,167 bp
  • GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC, chromosome 1 at 136,625,353 bp
  • AAAAT to AAAATCAAAT, chromosome 1 at 138,092,244 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • T to A, chromosome 2 at 75,858,926 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to C, chromosome 2 at 85,041,427 bp
  • A to T, chromosome 2 at 88,728,745 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to T, chromosome 2 at 161,534,545 bp
  • T to A, chromosome 3 at 70,018,836 bp
  • T to G, chromosome 3 at 83,942,788 bp
  • C to T, chromosome 4 at 41,379,257 bp
  • A to G, chromosome 4 at 98,820,296 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • T to A, chromosome 4 at 143,416,871 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • T to C, chromosome 4 at 152,121,257 bp
  • C to A, chromosome 5 at 25,285,079 bp
  • G to A, chromosome 5 at 92,181,936 bp
  • G to T, chromosome 5 at 129,115,095 bp
  • T to A, chromosome 6 at 18,225,914 bp
  • C to A, chromosome 6 at 48,460,763 bp
  • A to C, chromosome 6 at 48,463,531 bp
  • T to A, chromosome 6 at 48,977,755 bp
  • T to C, chromosome 6 at 57,431,958 bp
  • T to C, chromosome 6 at 66,553,561 bp
  • A to G, chromosome 6 at 83,772,259 bp
  • A to G, chromosome 6 at 85,444,318 bp
  • A to G, chromosome 7 at 45,553,798 bp
  • A to T, chromosome 7 at 105,389,839 bp
  • A to G, chromosome 7 at 119,656,039 bp
  • A to G, chromosome 7 at 126,768,594 bp
  • A to G, chromosome 7 at 135,670,695 bp
  • T to G, chromosome 8 at 15,106,379 bp
  • A to G, chromosome 8 at 108,945,177 bp
  • G to T, chromosome 8 at 123,892,064 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to T, chromosome 9 at 39,720,115 bp
  • T to A, chromosome 9 at 40,101,119 bp
  • A to G, chromosome 9 at 64,889,605 bp
  • G to A, chromosome 9 at 70,581,301 bp
  • A to G, chromosome 9 at 75,893,790 bp
  • C to T, chromosome 9 at 106,373,897 bp
  • T to A, chromosome 9 at 121,741,694 bp
  • T to C, chromosome 9 at 123,100,537 bp
  • T to A, chromosome 10 at 19,894,315 bp
  • T to C, chromosome 10 at 24,050,425 bp
  • T to A, chromosome 10 at 26,849,942 bp
  • T to A, chromosome 10 at 67,157,998 bp
  • G to A, chromosome 10 at 76,004,884 bp
  • A to G, chromosome 10 at 80,585,606 bp
  • A to T, chromosome 10 at 120,106,021 bp
  • A to T, chromosome 10 at 123,119,137 bp
  • A to G, chromosome 10 at 127,336,727 bp
  • A to G, chromosome 10 at 127,563,804 bp
  • A to G, chromosome 10 at 129,912,167 bp
  • A to G, chromosome 11 at 66,044,683 bp
  • A to G, chromosome 11 at 82,905,366 bp
  • G to T, chromosome 11 at 96,961,365 bp
  • A to G, chromosome 11 at 108,606,325 bp
  • T to C, chromosome 11 at 116,977,670 bp
  • A to T, chromosome 11 at 121,250,369 bp
  • A to G, chromosome 12 at 5,137,876 bp
  • A to G, chromosome 12 at 54,062,088 bp
  • A to G, chromosome 12 at 84,396,858 bp
  • A to G, chromosome 12 at 87,517,276 bp
  • T to A, chromosome 12 at 113,544,429 bp
  • T to A, chromosome 13 at 9,878,335 bp
  • T to A, chromosome 13 at 116,894,886 bp
  • A to T, chromosome 14 at 24,154,647 bp
  • G to A, chromosome 14 at 54,584,987 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • T to A, chromosome 15 at 44,547,513 bp
  • G to A, chromosome 15 at 44,581,741 bp
  • A to G, chromosome 15 at 75,657,675 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • G to A, chromosome 15 at 86,142,808 bp
  • T to A, chromosome 15 at 89,159,002 bp
  • C to A, chromosome 15 at 98,136,069 bp
  • G to A, chromosome 15 at 98,378,396 bp
  • A to G, chromosome 15 at 99,579,366 bp
  • T to A, chromosome 15 at 101,545,156 bp
  • G to A, chromosome 15 at 103,531,406 bp
  • T to C, chromosome 16 at 22,818,541 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • G to T, chromosome 16 at 97,950,155 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • A to G, chromosome 17 at 19,522,050 bp
  • A to G, chromosome 17 at 20,268,304 bp
  • T to C, chromosome 17 at 32,482,138 bp
  • T to C, chromosome 17 at 36,325,216 bp
  • A to T, chromosome 18 at 19,989,680 bp
  • A to T, chromosome 18 at 46,963,747 bp
  • G to A, chromosome 18 at 53,194,444 bp
  • G to T, chromosome 18 at 54,895,565 bp
  • A to G, chromosome 19 at 4,698,605 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • G to A, chromosome 19 at 10,439,213 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2049 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040056-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.