Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2568Btlr/Mmmh
Stock Number:
040427-MU
Citation ID:
RRID:MMRRC_040427-MU
Other Names:
R2568 (G1), C57BL/6J-MtgxR2568Btlr
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Prdx1
Name: peroxiredoxin 1
Synonyms: OSF-3, MSP23, Tdpx2, macrophage 23kDa stress protein, macrophase stress protein 22kDa, osteoblast specific factor 3, Trx dependent peroxide reductase 2, thioredoxin dependent peroxide reductase 2, TDX2, Paga, PrxI, PAG, Prx I, prx1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18477
HGNC: HGNC:9352
Homologene: 99789
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Gpi1
Name: glucose-6-phosphate isomerase 1
Synonyms: Gpi-1t, Gpi-1, Org, Gpi-1s, Gpi-1r, Gpi1-t, Gpi1-s, Gpi1-r, MF, maturation factor, NK, AMF, autocrine motility factor, neuroleukin, NK/GPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14751
HGNC: HGNC:4458
Homologene: 145
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Trim39
Name: tripartite motif-containing 39
Synonyms: RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, Rnf23, E130103K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 79263
Homologene: 10940
Cthrc1
Name: collagen triple helix repeat containing 1
Synonyms: 1110014B07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68588
Homologene: 16320
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: LOC382045, PGR27, Gpr114
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382045
Homologene: 17828
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, 9430067K14Rik, Plekhm1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Gdf5
Name: growth differentiation factor 5
Synonyms: cartilage-derived morphogenetic protein-1, CDMP-1, bp, brp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14563
HGNC: HGNC:4220
Homologene: 468
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Tulp3
Name: TUB like protein 3
Synonyms: 2310022L06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22158
Homologene: 20711
Sirpa
Name: signal-regulatory protein alpha
Synonyms: SIRP, P84, SHPS-1, Bit, CD172a, Idd13.2, Ptpns1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19261
HGNC: HGNC:9662
Homologene: 7246
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Adgrf5
Name: adhesion G protein-coupled receptor F5
Synonyms: 8430401C09Rik, Gpr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224792
VEGA: 17
Homologene: 9065
Marco
Name: macrophage receptor with collagenous structure
Synonyms: Scara2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17167
HGNC: HGNC:6895
Homologene: 4928
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Cfap206
Name: cilia and flagella associated protein 206
Synonyms: 1700003M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69329
Homologene: 18713
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ecm2
Name: extracellular matrix protein 2, female organ and adipocyte specific
Synonyms: 9030618O22Rik, tenonectin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 407800
VEGA: 13
HGNC: HGNC:3154
Homologene: 1064
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 9430041O17Rik, 2010203O03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234214
Homologene: 83295
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: MP-1, 2310012C15Rik, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Dhx30
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Dtx1
Name: deltex 1, E3 ubiquitin ligase
Synonyms: Fxit1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14357
HGNC: HGNC:3060
Homologene: 74522
Apoh
Name: apolipoprotein H
Synonyms: beta-2-glycoprotein 1, beta-2-GPI, B2GPI
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11818
HGNC: HGNC:616
Homologene: 26
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Tmc6
Name: transmembrane channel-like gene family 6
Synonyms: EVER1, D11Ertd204e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217353
Homologene: 5258
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77352
Homologene: 52328
Myot
Name: myotilin
Synonyms: 5530402I04Rik, Ttid
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58916
Homologene: 4942
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Rbks
Name: ribokinase
Synonyms: 5230400M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71336
Homologene: 5482
Klhl29
Name: kelch-like 29
Synonyms: A230106N14Rik, Kbtbd9
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208439
VEGA: 12
Homologene: 66272
Slc35c1
Name: solute carrier family 35, member C1
Synonyms: FUCT1, E430007K15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228368
Homologene: 41258
Krt83
Name: keratin 83
Synonyms: 5430421N21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100126226
HGNC: HGNC:6460
Homologene: 68248
Fam13a
Name: family with sequence similarity 13, member A
Synonyms: D430015B01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58909
Homologene: 135847
Eeig2
Name: EEIG family member 2
Synonyms: 1600010D10Rik, B430201A12Rik, Fam102b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329739
Homologene: 46568
Fam243
Name: family with sequence similarity 243
Synonyms: 4930563D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75328
VEGA: 16
Homologene: 57100
Vmn1r38
Name: vomeronasal 1 receptor 38
Synonyms: V1rc13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171186
Homologene: 110800
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Thg1l
Name: tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Synonyms: 1700121M19Rik, 5730409G07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66628
Homologene: 5959
Mylk4
Name: myosin light chain kinase family, member 4
Synonyms: EG238564
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238564
Homologene: 66243
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Vmn2r23
Name: vomeronasal 2, receptor 23
Synonyms: EG435916
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435916
Homologene: 135826
Gm4868
Name: predicted gene 4868
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231736
Homologene: 138658
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Il1b
Name: interleukin 1 beta
Synonyms: IL-1B, IL-1beta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16176
HGNC: HGNC:5992
Homologene: 481
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • T to C, chromosome 1 at 120,494,785 bp
  • A to C, chromosome 1 at 134,835,771 bp
  • A to T, chromosome 1 at 135,363,964 bp
  • T to A, chromosome 1 at 156,392,749 bp
  • T to A, chromosome 1 at 162,836,259 bp
  • T to C, chromosome 2 at 36,479,974 bp
  • C to T, chromosome 2 at 66,273,469 bp
  • A to G, chromosome 2 at 82,990,431 bp
  • T to C, chromosome 2 at 92,458,880 bp
  • G to A, chromosome 2 at 112,675,874 bp
  • A to T, chromosome 2 at 129,367,322 bp
  • T to C, chromosome 2 at 129,615,648 bp
  • C to G, chromosome 2 at 155,942,090 bp
  • A to T, chromosome 3 at 29,582,931 bp
  • T to A, chromosome 3 at 65,553,130 bp
  • T to A, chromosome 3 at 108,978,848 bp
  • T to C, chromosome 3 at 124,575,365 bp
  • T to A, chromosome 4 at 34,711,566 bp
  • T to G, chromosome 4 at 116,693,800 bp
  • A to T, chromosome 4 at 120,268,764 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • T to A, chromosome 5 at 31,665,752 bp
  • C to A, chromosome 5 at 120,710,184 bp
  • A to G, chromosome 5 at 125,848,011 bp
  • G to A, chromosome 5 at 144,843,369 bp
  • T to G, chromosome 6 at 58,935,609 bp
  • T to A, chromosome 6 at 66,776,971 bp
  • C to T, chromosome 6 at 122,828,372 bp
  • T to A, chromosome 6 at 123,742,188 bp
  • C to T, chromosome 6 at 128,327,638 bp
  • T to A, chromosome 7 at 34,216,016 bp
  • A to G, chromosome 7 at 49,597,564 bp
  • A to G, chromosome 7 at 105,056,671 bp
  • A to T, chromosome 8 at 45,795,370 bp
  • A to T, chromosome 8 at 94,934,021 bp
  • G to A, chromosome 8 at 122,862,024 bp
  • A to C, chromosome 8 at 124,556,955 bp
  • A to T, chromosome 9 at 22,279,238 bp
  • A to T, chromosome 9 at 67,229,320 bp
  • A to G, chromosome 9 at 75,123,040 bp
  • T to C, chromosome 9 at 75,151,897 bp
  • A to T, chromosome 9 at 106,063,076 bp
  • A to G, chromosome 9 at 110,097,195 bp
  • A to G, chromosome 9 at 113,878,764 bp
  • A to T, chromosome 11 at 9,333,310 bp
  • A to G, chromosome 11 at 45,951,565 bp
  • T to G, chromosome 11 at 60,708,812 bp
  • C to T, chromosome 11 at 66,080,485 bp
  • T to G, chromosome 11 at 108,404,871 bp
  • A to G, chromosome 11 at 117,772,820 bp
  • A to G, chromosome 12 at 5,091,350 bp
  • A to G, chromosome 12 at 52,887,278 bp
  • G to T, chromosome 13 at 6,575,092 bp
  • C to T, chromosome 13 at 24,883,891 bp
  • T to C, chromosome 13 at 32,722,018 bp
  • T to A, chromosome 13 at 49,530,129 bp
  • A to G, chromosome 14 at 14,999,112 bp
  • A to G, chromosome 14 at 30,082,511 bp
  • T to C, chromosome 15 at 8,201,269 bp
  • T to A, chromosome 15 at 39,084,488 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • G to T, chromosome 15 at 101,487,827 bp
  • A to G, chromosome 16 at 58,925,923 bp
  • A to G, chromosome 16 at 92,321,319 bp
  • T to A, chromosome 17 at 36,269,164 bp
  • A to G, chromosome 17 at 43,437,671 bp
  • C to T, chromosome 17 at 84,726,649 bp
  • A to G, chromosome 18 at 44,337,216 bp
  • T to C, chromosome 18 at 89,036,980 bp
  • C to A, chromosome 19 at 10,248,152 bp
  • C to G, chromosome 19 at 55,180,999 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040427-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.