Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6791Btlr/Mmmh
Stock Number:
044904-MU
Citation ID:
RRID:MMRRC_044904-MU
Other Names:
R6791 (G1)
Major Collection:

Strain Information

Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Bet1l
Name: Bet1 golgi vesicular membrane trafficking protein like
Synonyms: 2610021K23Rik, golgi SNARE, Gs15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54399
Homologene: 10293
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 93,066,137 bp
  • T to C, chromosome 1 at 193,334,861 bp
  • T to C, chromosome 2 at 122,093,443 bp
  • G to A, chromosome 3 at 55,127,561 bp
  • T to C, chromosome 3 at 64,538,159 bp
  • A to G, chromosome 3 at 89,095,352 bp
  • T to C, chromosome 4 at 34,711,414 bp
  • C to T, chromosome 4 at 47,300,518 bp
  • A to T, chromosome 4 at 63,363,959 bp
  • A to G, chromosome 4 at 125,007,183 bp
  • T to A, chromosome 4 at 143,895,682 bp
  • TGCCGCCGCCGCCGCCACCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC, chromosome 5 at 23,499,476 bp
  • C to A, chromosome 5 at 86,919,257 bp
  • G to A, chromosome 6 at 91,506,857 bp
  • G to A, chromosome 6 at 138,141,807 bp
  • A to G, chromosome 7 at 29,934,435 bp
  • A to G, chromosome 7 at 43,813,260 bp
  • A to G, chromosome 7 at 79,460,109 bp
  • A to G, chromosome 7 at 140,854,505 bp
  • A to T, chromosome 7 at 143,819,108 bp
  • T to C, chromosome 8 at 25,752,215 bp
  • T to G, chromosome 8 at 95,564,655 bp
  • A to G, chromosome 8 at 111,689,349 bp
  • T to C, chromosome 9 at 13,805,382 bp
  • T to C, chromosome 9 at 18,385,130 bp
  • T to G, chromosome 9 at 39,600,659 bp
  • T to C, chromosome 9 at 63,140,354 bp
  • A to G, chromosome 9 at 64,012,227 bp
  • A to C, chromosome 9 at 110,419,949 bp
  • TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA to TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA, chromosome 10 at 100,341,499 bp
  • G to A, chromosome 10 at 129,463,154 bp
  • T to A, chromosome 11 at 9,378,504 bp
  • T to C, chromosome 11 at 50,859,774 bp
  • C to A, chromosome 11 at 58,346,272 bp
  • T to C, chromosome 11 at 58,832,077 bp
  • T to A, chromosome 11 at 69,908,510 bp
  • T to C, chromosome 11 at 83,758,341 bp
  • T to C, chromosome 11 at 97,680,602 bp
  • T to C, chromosome 11 at 98,109,510 bp
  • A to T, chromosome 13 at 22,006,067 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to G, chromosome 13 at 119,766,593 bp
  • G to A, chromosome 14 at 56,386,982 bp
  • A to G, chromosome 14 at 75,730,678 bp
  • T to G, chromosome 14 at 101,608,259 bp
  • T to C, chromosome 17 at 42,710,883 bp
  • A to G, chromosome 17 at 48,309,219 bp
  • C to A, chromosome 18 at 61,307,676 bp
  • C to T, chromosome 19 at 3,600,753 bp
  • T to A, chromosome 19 at 11,511,836 bp
  • A to T, chromosome 19 at 44,788,821 bp
  • A to T, chromosome Y at 1,325,042 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6791 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.