Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6885Btlr/Mmmh
Stock Number:
045031-MU
Citation ID:
RRID:MMRRC_045031-MU
Other Names:
R6885 (G1)
Major Collection:

Strain Information

Mafb
Name: MAF bZIP transcription factor B
Synonyms: Kreisler, Krml1, Krml
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16658
HGNC: HGNC:6408
Homologene: 31315
Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,264,378 bp
  • C to T, chromosome 1 at 72,643,036 bp
  • G to A, chromosome 2 at 13,318,278 bp
  • T to A, chromosome 2 at 30,415,196 bp
  • A to G, chromosome 2 at 88,643,597 bp
  • A to G, chromosome 2 at 126,752,310 bp
  • A to T, chromosome 2 at 132,554,074 bp
  • A to G, chromosome 2 at 160,366,019 bp
  • TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC to TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC, chromosome 3 at 51,697,579 bp
  • T to C, chromosome 3 at 58,416,208 bp
  • T to A, chromosome 3 at 84,692,506 bp
  • T to C, chromosome 3 at 87,742,620 bp
  • T to C, chromosome 3 at 129,218,608 bp
  • A to G, chromosome 4 at 109,309,164 bp
  • A to T, chromosome 4 at 133,665,481 bp
  • T to C, chromosome 4 at 134,215,149 bp
  • T to C, chromosome 4 at 143,793,533 bp
  • T to C, chromosome 5 at 8,973,635 bp
  • A to T, chromosome 5 at 21,834,344 bp
  • T to C, chromosome 5 at 53,653,151 bp
  • T to A, chromosome 5 at 64,103,878 bp
  • T to C, chromosome 5 at 76,559,042 bp
  • A to G, chromosome 5 at 91,594,210 bp
  • T to C, chromosome 5 at 120,544,437 bp
  • T to C, chromosome 5 at 149,050,661 bp
  • C to T, chromosome 5 at 151,648,284 bp
  • T to C, chromosome 6 at 56,986,057 bp
  • T to A, chromosome 6 at 78,381,055 bp
  • T to C, chromosome 6 at 125,378,730 bp
  • G to T, chromosome 7 at 39,408,156 bp
  • A to G, chromosome 7 at 120,520,109 bp
  • T to C, chromosome 7 at 128,725,109 bp
  • T to C, chromosome 8 at 44,952,452 bp
  • C to A, chromosome 8 at 120,229,482 bp
  • A to T, chromosome 8 at 123,235,558 bp
  • T to C, chromosome 9 at 95,560,043 bp
  • A to G, chromosome 9 at 96,686,464 bp
  • T to C, chromosome 10 at 8,784,221 bp
  • T to A, chromosome 10 at 80,343,631 bp
  • T to G, chromosome 11 at 30,138,634 bp
  • A to T, chromosome 11 at 30,834,307 bp
  • T to A, chromosome 11 at 36,023,580 bp
  • A to G, chromosome 11 at 67,683,387 bp
  • A to T, chromosome 11 at 73,787,100 bp
  • A to G, chromosome 11 at 78,466,979 bp
  • A to G, chromosome 11 at 79,047,295 bp
  • A to T, chromosome 11 at 82,102,697 bp
  • A to G, chromosome 11 at 118,090,772 bp
  • T to A, chromosome 12 at 31,894,199 bp
  • A to T, chromosome 13 at 92,762,869 bp
  • G to A, chromosome 15 at 53,101,692 bp
  • T to C, chromosome 15 at 92,243,099 bp
  • T to C, chromosome 15 at 101,796,398 bp
  • A to G, chromosome 16 at 17,927,430 bp
  • T to A, chromosome 17 at 19,380,195 bp
  • G to A, chromosome 17 at 24,512,292 bp
  • T to C, chromosome 17 at 34,472,945 bp
  • T to G, chromosome 17 at 71,215,150 bp
  • T to C, chromosome 17 at 79,852,553 bp
  • A to G, chromosome 18 at 74,206,839 bp
  • T to C, chromosome 19 at 7,458,331 bp
  • C to T, chromosome 19 at 9,875,132 bp
  • T to A, chromosome 19 at 25,147,378 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6885 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045031-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.