Strain Name:
C57BL/6J-MtgxR6885Btlr/Mmmh
Stock Number:
045031-MU
Citation ID:
RRID:MMRRC_045031-MU
Other Names:
R6885 (G1)
Major Collection:

Strain Information

Mafb
Name: MAF bZIP transcription factor B
Synonyms: Kreisler, Krml1, Krml
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16658
HGNC: HGNC:6408
Homologene: 31315
Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, non-erythrocytic, 9930031C03Rik, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Pigv
Name: phosphatidylinositol glycan anchor biosynthesis, class V
Synonyms: D430024F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230801
Homologene: 5354
Rbpj
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: CBF1, Igkrsbp, RBP-J kappa, RBPjk, Igkjrb, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
HGNC: HGNC:5724
Homologene: 7511
Mcmbp
Name: minichromosome maintenance complex binding protein
Synonyms: 1110007A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210711
Homologene: 11749
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Cog5
Name: component of oligomeric golgi complex 5
Synonyms: GOLTC1, GTC90, 5430405C01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238123
VEGA: 12
Homologene: 42221
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Crot
Name: carnitine O-octanoyltransferase
Synonyms: 1200003H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74114
HGNC: HGNC:2366
Homologene: 10899
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224619
Homologene: 12998
Hmgb1
Name: high mobility group box 1
Synonyms: Hmg1, HMG-1, p30, SBP-1, amphoterin, DEF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15289
HGNC: HGNC:4983
Homologene: 135819
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Tsc22d2
Name: TSC22 domain family, member 2
Synonyms: 1810043J12Rik, 5530402M19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72033
Homologene: 8860
Atl2
Name: atlastin GTPase 2
Synonyms: Aip-2, 2010110I21Rik, Arl6ip2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56298
VEGA: 17
Homologene: 56949
Usp8
Name: ubiquitin specific peptidase 8
Synonyms: Ubpy
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 84092
Homologene: 3782
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3p, SEC3, A730011E05Rik, 2810407P21Rik, Sec3l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69940
Homologene: 41241
Parm1
Name: prostate androgen-regulated mucin-like protein 1
Synonyms: 2210012L08Rik, 9130213B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231440
Homologene: 41036
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Rtn3
Name: reticulon 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20168
VEGA: 19
Homologene: 24934
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Gas7
Name: growth arrest specific 7
Synonyms: Gas7-cb, B230343A10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14457
HGNC: HGNC:4169
Homologene: 69015
Krt73
Name: keratin 73
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223915
Homologene: 27875
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Cntn1
Name: contactin 1
Synonyms: CNTN, F3cam, usl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12805
HGNC: HGNC:2171
Homologene: 7274
Zbtb38
Name: zinc finger and BTB domain containing 38
Synonyms: A930014K01Rik, Zenon homolog, CIBZ
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245007
Homologene: 19529
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Pramel25
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194227
Homologene: 103830
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Or1e30
Name: olfactory receptor family 1 subfamily E member 30
Synonyms: GA_x6K02T2P1NL-3938806-3939741, MOR135-26, Olfr390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258344
Homologene: 115483
Rfc3
Name: replication factor C (activator 1) 3
Synonyms: 2810416I22Rik, 38kDa, 38kDa, Recc3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69263
HGNC: HGNC:9971
Homologene: 2188
Crat
Name: carnitine acetyltransferase
Synonyms: CARAT
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12908
HGNC: HGNC:2342
Homologene: 598
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: 1110002C08Rik, D11Ertd18e, HCP1, heme carrier protein 1, PCFT
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52466
Homologene: 41693
Pgm2
Name: phosphoglucomutase 2
Synonyms: Pgm-1, 3230402E02Rik, Pgm1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66681
HGNC: HGNC:8906
Homologene: 6693
Vmn1r5
Name: vomeronasal 1 receptor 5
Synonyms: V1rc19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171192
Homologene: 128340
Spata2l
Name: spermatogenesis associated 2-like
Synonyms: 2610039E05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78779
Homologene: 32729
Plekhg6
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Synonyms: LOC213522
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213522
Homologene: 32395
Lrrc71
Name: leucine rich repeat containing 71
Synonyms: 4933430H15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74485
Homologene: 83646
Gpcpd1
Name: glycerophosphocholine phosphodiesterase 1
Synonyms: 2310032D16Rik, 2310004G06Rik, Prei4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74182
Homologene: 10478
Adamtsl5
Name: ADAMTS-like 5
Synonyms: 2010109H09Rik, Thsd6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66548
Homologene: 19803
Btnl4
Name: butyrophilin-like 4
Synonyms: NG11, EG632126, Btn3a3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 632126
Homologene: 106849
Maml3
Name: mastermind like transcriptional coactivator 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433586
Homologene: 41284
Ska1
Name: spindle and kinetochore associated complex subunit 1
Synonyms: 2810433K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66468
VEGA: 18
Homologene: 11975
Catsper4
Name: cation channel, sperm associated 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329954
Homologene: 18638
Paqr9
Name: progestin and adipoQ receptor family member IX
Synonyms: 1700020G04Rik, C730029A08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75552
Homologene: 18882
Reg3a
Name: regenerating islet-derived 3 alpha
Synonyms: RegIII (alpha)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19694
HGNC: HGNC:8601
Homologene: 136247
Ccl12
Name: C-C motif chemokine ligand 12
Synonyms: MCP-5, Scya12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20293
Homologene: 2245
Slc25a1
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Synonyms: Dgsj, Slc20a3, 2610100G11Rik, 1300019P08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13358
Homologene: 4362
Tmem154
Name: transmembrane protein 154
Synonyms: 9930117H01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320782
Homologene: 45569
Or4s2
Name: olfactory receptor family 4 subfamily S member 2
Synonyms: GA_x6K02T2PRF0-44595-45531, GA_x6K02T2Q125-50121628-50122030, MOR230-9, Olfr526-ps1, Olfr1191
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404399
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,264,378 bp
  • C to T, chromosome 1 at 72,643,036 bp
  • G to A, chromosome 2 at 13,318,278 bp
  • T to A, chromosome 2 at 30,415,196 bp
  • A to G, chromosome 2 at 88,643,597 bp
  • A to G, chromosome 2 at 126,752,310 bp
  • A to T, chromosome 2 at 132,554,074 bp
  • A to G, chromosome 2 at 160,366,019 bp
  • TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC to TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC, chromosome 3 at 51,697,579 bp
  • T to C, chromosome 3 at 58,416,208 bp
  • T to A, chromosome 3 at 84,692,506 bp
  • T to C, chromosome 3 at 87,742,620 bp
  • T to C, chromosome 3 at 129,218,608 bp
  • A to G, chromosome 4 at 109,309,164 bp
  • A to T, chromosome 4 at 133,665,481 bp
  • T to C, chromosome 4 at 134,215,149 bp
  • T to C, chromosome 4 at 143,793,533 bp
  • T to C, chromosome 5 at 8,973,635 bp
  • A to T, chromosome 5 at 21,834,344 bp
  • T to C, chromosome 5 at 53,653,151 bp
  • T to A, chromosome 5 at 64,103,878 bp
  • T to C, chromosome 5 at 76,559,042 bp
  • A to G, chromosome 5 at 91,594,210 bp
  • T to C, chromosome 5 at 120,544,437 bp
  • T to C, chromosome 5 at 149,050,661 bp
  • C to T, chromosome 5 at 151,648,284 bp
  • T to C, chromosome 6 at 56,986,057 bp
  • T to A, chromosome 6 at 78,381,055 bp
  • T to C, chromosome 6 at 125,378,730 bp
  • G to T, chromosome 7 at 39,408,156 bp
  • A to G, chromosome 7 at 120,520,109 bp
  • T to C, chromosome 7 at 128,725,109 bp
  • T to C, chromosome 8 at 44,952,452 bp
  • C to A, chromosome 8 at 120,229,482 bp
  • A to T, chromosome 8 at 123,235,558 bp
  • T to C, chromosome 9 at 95,560,043 bp
  • A to G, chromosome 9 at 96,686,464 bp
  • T to C, chromosome 10 at 8,784,221 bp
  • T to A, chromosome 10 at 80,343,631 bp
  • T to G, chromosome 11 at 30,138,634 bp
  • A to T, chromosome 11 at 30,834,307 bp
  • T to A, chromosome 11 at 36,023,580 bp
  • A to G, chromosome 11 at 67,683,387 bp
  • A to T, chromosome 11 at 73,787,100 bp
  • A to G, chromosome 11 at 78,466,979 bp
  • A to G, chromosome 11 at 79,047,295 bp
  • A to T, chromosome 11 at 82,102,697 bp
  • A to G, chromosome 11 at 118,090,772 bp
  • T to A, chromosome 12 at 31,894,199 bp
  • A to T, chromosome 13 at 92,762,869 bp
  • G to A, chromosome 15 at 53,101,692 bp
  • T to C, chromosome 15 at 92,243,099 bp
  • T to C, chromosome 15 at 101,796,398 bp
  • A to G, chromosome 16 at 17,927,430 bp
  • T to A, chromosome 17 at 19,380,195 bp
  • G to A, chromosome 17 at 24,512,292 bp
  • T to C, chromosome 17 at 34,472,945 bp
  • T to G, chromosome 17 at 71,215,150 bp
  • T to C, chromosome 17 at 79,852,553 bp
  • A to G, chromosome 18 at 74,206,839 bp
  • T to C, chromosome 19 at 7,458,331 bp
  • C to T, chromosome 19 at 9,875,132 bp
  • T to A, chromosome 19 at 25,147,378 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6885 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045031-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.