Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7018Btlr/Mmmh
Stock Number:
045119-MU
Citation ID:
RRID:MMRRC_045119-MU
Other Names:
R7018 (G1)
Major Collection:

Strain Information

Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 53,064,084 bp
  • T to C, chromosome 1 at 65,927,971 bp
  • A to T, chromosome 1 at 87,185,948 bp
  • T to C, chromosome 1 at 93,284,421 bp
  • A to G, chromosome 1 at 126,025,048 bp
  • T to A, chromosome 1 at 153,136,742 bp
  • G to A, chromosome 1 at 181,626,944 bp
  • A to G, chromosome 1 at 193,114,855 bp
  • A to G, chromosome 2 at 35,293,506 bp
  • T to A, chromosome 2 at 88,093,256 bp
  • A to T, chromosome 2 at 121,369,058 bp
  • T to A, chromosome 2 at 181,081,724 bp
  • T to A, chromosome 3 at 68,041,247 bp
  • T to C, chromosome 3 at 93,397,900 bp
  • T to C, chromosome 3 at 107,458,862 bp
  • G to A, chromosome 3 at 138,049,558 bp
  • T to G, chromosome 4 at 59,390,627 bp
  • A to G, chromosome 4 at 130,135,868 bp
  • T to C, chromosome 4 at 130,532,118 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to C, chromosome 4 at 135,703,824 bp
  • T to C, chromosome 4 at 141,493,444 bp
  • C to T, chromosome 5 at 86,428,570 bp
  • G to A, chromosome 5 at 118,751,986 bp
  • T to C, chromosome 6 at 43,288,731 bp
  • T to C, chromosome 6 at 125,356,951 bp
  • T to C, chromosome 7 at 6,708,839 bp
  • C to A, chromosome 7 at 43,726,702 bp
  • T to G, chromosome 7 at 108,286,344 bp
  • C to A, chromosome 7 at 127,882,322 bp
  • T to C, chromosome 8 at 102,634,321 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 92,264,662 bp
  • T to A, chromosome 9 at 95,866,694 bp
  • T to G, chromosome 9 at 110,385,816 bp
  • G to T, chromosome 10 at 74,466,354 bp
  • C to T, chromosome 12 at 24,575,997 bp
  • A to T, chromosome 12 at 65,225,762 bp
  • T to A, chromosome 12 at 73,108,953 bp
  • T to C, chromosome 12 at 115,312,365 bp
  • T to A, chromosome 13 at 9,659,278 bp
  • T to G, chromosome 13 at 13,743,459 bp
  • A to T, chromosome 13 at 55,166,200 bp
  • C to T, chromosome 13 at 97,965,435 bp
  • T to C, chromosome 14 at 55,592,233 bp
  • T to A, chromosome 14 at 123,409,821 bp
  • C to A, chromosome 15 at 9,007,285 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 35,000,426 bp
  • A to G, chromosome 16 at 59,110,607 bp
  • T to C, chromosome 16 at 79,024,853 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 37,952,502 bp
  • G to A, chromosome 17 at 68,486,943 bp
  • T to C, chromosome 17 at 80,216,181 bp
  • G to T, chromosome 17 at 81,055,897 bp
  • T to A, chromosome 17 at 86,136,415 bp
  • T to C, chromosome 18 at 20,328,738 bp
  • C to A, chromosome 18 at 61,707,554 bp
  • G to T, chromosome 18 at 62,937,049 bp
  • G to T, chromosome 19 at 5,706,132 bp
  • T to C, chromosome 19 at 5,869,518 bp
  • T to A, chromosome 19 at 11,699,419 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045119-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.