Strain Name:
C57BL/6J-MtgxR7018Btlr/Mmmh
Stock Number:
045119-MU
Citation ID:
RRID:MMRRC_045119-MU
Other Names:
R7018 (G1)
Major Collection:

Strain Information

Gsn
Name: gelsolin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227753
HGNC: HGNC:4620
Homologene: 147
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, Cad11, OB-cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Kcnq2
Name: potassium voltage-gated channel, subfamily Q, member 2
Synonyms: Nmf134, KQT2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16536
HGNC: HGNC:6296
Homologene: 26174
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kcr2-4, Kv3.4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Hcrtr1
Name: hypocretin (orexin) receptor 1
Synonyms: OX1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230777
HGNC: HGNC:4848
Homologene: 37492
Med13l
Name: mediator complex subunit 13-like
Synonyms: 9030618F05Rik, Trap240L, Thrap2, 6330591G05Rik, 2210413I17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Srbd1
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78586
VEGA: 17
Homologene: 9994
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Peg3
Name: paternally expressed 3
Synonyms: Gcap4, End4, Pw1, Zfp102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Grhl1
Name: grainyhead like transcription factor 1
Synonyms: LBP-32, p61 MGR, p70 MGR, Tcfcp2l2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 195733
VEGA: 12
Homologene: 32219
Susd1
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 634731
Homologene: 11204
Frmd8
Name: FERM domain containing 8
Synonyms: 4931429L16Rik, iTAP, 2310035N23Rik, 1200004M23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67457
Homologene: 32653
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: D13Bwg1089e, Rho specific exchange factor, 9230110L08Rik, RIP2, Rgnef, p190RhoGEF, RhoGEF
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Fgfr4
Name: fibroblast growth factor receptor 4
Synonyms: Fgfr-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14186
HGNC: HGNC:3691
Homologene: 20461
Tnfrsf1a
Name: tumor necrosis factor receptor superfamily, member 1a
Synonyms: TNFRI, p55, p55-R, TNF-R55, CD120a, TNFRp55, TNF-alpha-R1, TNFAR, TNFalpha-R1, Tnfr1, TNF-alphaR1, TNF receptor alpha chain, TNF-R1, TNFR60, TNF-R-I
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21937
Homologene: 828
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, Gm980, A230079K17Rik, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Nalcn
Name: sodium leak channel, non-selective
Synonyms: Vgcnl1, A530023G15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Kcnk7
Name: potassium channel, subfamily K, member 7
Synonyms: 2310014G03Rik, Mlk3, Kcnk8, Knot
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16530
HGNC: HGNC:6282
Homologene: 43131
Nckap5
Name: NCK-associated protein 5
Synonyms: E030049G20Rik, D130011D22Rik, LOC380609
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Pcyox1l
Name: prenylcysteine oxidase 1 like
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240334
Homologene: 23429
Ttc39d
Name: tetratricopeptide repeat domain 39D
Synonyms: 4930560E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67737
Homologene: 65053
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
L3mbtl4
Name: L3MBTL4 histone methyl-lysine binding protein
Synonyms: D930040M24Rik, A730037L19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320858
Homologene: 114383
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: Prss7, enterokinase, A130097D21Rik, enteropeptidase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Mylk
Name: myosin, light polypeptide kinase
Synonyms: MLCK210, 9530072E15Rik, nmMlck, telokin, Mlck, MLCK108, A930019C19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Or5d37
Name: olfactory receptor family 5 subfamily D member 37
Synonyms: GA_x6K02T2Q125-49585842-49584862, Olfr1164, MOR174-11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258634
Homologene: 74077
Klk13
Name: kallikrein related-peptidase 13
Synonyms: mGk-13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 626834
HGNC: HGNC:6361
Homologene: 56714
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: Snep, 6720455I24Rik, D430044C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208777
Homologene: 14708
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Rnf31
Name: ring finger protein 31
Synonyms: HOIP, Paul
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268749
Homologene: 33228
Prss56
Name: serine protease 56
Synonyms: Prss56, 1700027L20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69453
Homologene: 79885
Or5p66
Name: olfactory receptor family 5 subfamily P member 66
Synonyms: MOR204-17, GA_x6K02T2PBJ9-10617173-10616229, Olfr490
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258491
Homologene: 73955
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: Wdr20b, 4921538B03Rik, 4930427E19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70948
VEGA: 12
Plscr1
Name: phospholipid scramblase 1
Synonyms: Tras2, Tras1, NOR1, MuPLSCR2, TRA1, MmTRA1b, MmTRA1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22038
HGNC: HGNC:9092
Homologene: 41418
Or5h25
Name: olfactory receptor family 5 subfamily H member 25
Synonyms: Olfr1540-ps1, MOR113-7P, MOR183-7P, Olfr193, MOR113-7P, GA_x54KRFPKG5P-55338697-55337768
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257972
Homologene: 128162
Crygf
Name: crystallin, gamma F
Synonyms: DGcry-2, Cryg-2, 3110001K11Rik, Len-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12969
HGNC: HGNC:2411
Homologene: 128417
Ifnlr1
Name: interferon lambda receptor 1
Synonyms: IFNLR1, CRF2-12, Il28ra
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242700
Homologene: 52086
Or14j8
Name: olfactory receptor family 14 subfamily J member 8
Synonyms: Olfr761, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, Olfr1552-ps1, MOR218-12, MOR218-5P, MOR218-6P
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258094
Homologene: 134080
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Tmprss11a
Name: transmembrane protease, serine 11a
Synonyms: LOC194597
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 194597
Homologene: 62723
Thumpd2
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Nkain1
Name: Na+/K+ transporting ATPase interacting 1
Synonyms: 2610200G18Rik, 2810426C15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67149
Homologene: 11566
Slc30a2
Name: solute carrier family 30 (zinc transporter), member 2
Synonyms: Znt2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230810
Homologene: 40855
Oosp3
Name: oocyte secreted protein 3
Synonyms: Gm97, LOC225923
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225923
Iqcj
Name: IQ motif containing J
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 208426
Homologene: 132095
Six4
Name: sine oculis-related homeobox 4
Synonyms: TrexBF, AREC3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Gm5105
Name: predicted gene 5105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329763
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 53,064,084 bp
  • T to C, chromosome 1 at 65,927,971 bp
  • A to T, chromosome 1 at 87,185,948 bp
  • T to C, chromosome 1 at 93,284,421 bp
  • A to G, chromosome 1 at 126,025,048 bp
  • T to A, chromosome 1 at 153,136,742 bp
  • G to A, chromosome 1 at 181,626,944 bp
  • A to G, chromosome 1 at 193,114,855 bp
  • A to G, chromosome 2 at 35,293,506 bp
  • T to A, chromosome 2 at 88,093,256 bp
  • A to T, chromosome 2 at 121,369,058 bp
  • T to A, chromosome 2 at 181,081,724 bp
  • T to A, chromosome 3 at 68,041,247 bp
  • T to C, chromosome 3 at 93,397,900 bp
  • T to C, chromosome 3 at 107,458,862 bp
  • G to A, chromosome 3 at 138,049,558 bp
  • T to G, chromosome 4 at 59,390,627 bp
  • A to G, chromosome 4 at 130,135,868 bp
  • T to C, chromosome 4 at 130,532,118 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to C, chromosome 4 at 135,703,824 bp
  • T to C, chromosome 4 at 141,493,444 bp
  • C to T, chromosome 5 at 86,428,570 bp
  • G to A, chromosome 5 at 118,751,986 bp
  • T to C, chromosome 6 at 43,288,731 bp
  • T to C, chromosome 6 at 125,356,951 bp
  • T to C, chromosome 7 at 6,708,839 bp
  • C to A, chromosome 7 at 43,726,702 bp
  • T to G, chromosome 7 at 108,286,344 bp
  • C to A, chromosome 7 at 127,882,322 bp
  • T to C, chromosome 8 at 102,634,321 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 92,264,662 bp
  • T to A, chromosome 9 at 95,866,694 bp
  • T to G, chromosome 9 at 110,385,816 bp
  • G to T, chromosome 10 at 74,466,354 bp
  • C to T, chromosome 12 at 24,575,997 bp
  • A to T, chromosome 12 at 65,225,762 bp
  • T to A, chromosome 12 at 73,108,953 bp
  • T to C, chromosome 12 at 115,312,365 bp
  • T to A, chromosome 13 at 9,659,278 bp
  • T to G, chromosome 13 at 13,743,459 bp
  • A to T, chromosome 13 at 55,166,200 bp
  • C to T, chromosome 13 at 97,965,435 bp
  • T to C, chromosome 14 at 55,592,233 bp
  • T to A, chromosome 14 at 123,409,821 bp
  • C to A, chromosome 15 at 9,007,285 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 35,000,426 bp
  • A to G, chromosome 16 at 59,110,607 bp
  • T to C, chromosome 16 at 79,024,853 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 37,952,502 bp
  • G to A, chromosome 17 at 68,486,943 bp
  • T to C, chromosome 17 at 80,216,181 bp
  • G to T, chromosome 17 at 81,055,897 bp
  • T to A, chromosome 17 at 86,136,415 bp
  • T to C, chromosome 18 at 20,328,738 bp
  • C to A, chromosome 18 at 61,707,554 bp
  • G to T, chromosome 18 at 62,937,049 bp
  • G to T, chromosome 19 at 5,706,132 bp
  • T to C, chromosome 19 at 5,869,518 bp
  • T to A, chromosome 19 at 11,699,419 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045119-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.