Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7224Btlr/Mmmh
Stock Number:
045296-MU
Citation ID:
RRID:MMRRC_045296-MU
Other Names:
R7224 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Wasf1
Name: WASP family, member 1
Synonyms: WAVE-1, Scar, WAVE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Plxdc1
Name: plexin domain containing 1
Synonyms: Tem7, 2410003I07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72324
Homologene: 10700
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,397,261 bp
  • G to A, chromosome 1 at 71,570,855 bp
  • A to G, chromosome 1 at 74,517,229 bp
  • A to G, chromosome 1 at 87,403,725 bp
  • T to C, chromosome 1 at 172,494,782 bp
  • A to G, chromosome 2 at 35,902,673 bp
  • T to C, chromosome 2 at 52,334,659 bp
  • G to A, chromosome 2 at 119,658,396 bp
  • G to A, chromosome 2 at 156,144,375 bp
  • A to G, chromosome 3 at 36,605,728 bp
  • C to T, chromosome 3 at 60,035,854 bp
  • A to C, chromosome 3 at 86,395,246 bp
  • T to C, chromosome 3 at 100,582,053 bp
  • T to C, chromosome 3 at 103,735,860 bp
  • A to T, chromosome 3 at 105,669,084 bp
  • A to G, chromosome 3 at 108,428,203 bp
  • G to A, chromosome 4 at 61,832,385 bp
  • T to C, chromosome 4 at 62,524,050 bp
  • T to C, chromosome 4 at 104,780,598 bp
  • C to G, chromosome 4 at 130,219,199 bp
  • T to C, chromosome 4 at 132,497,413 bp
  • T to C, chromosome 5 at 16,836,594 bp
  • T to C, chromosome 5 at 28,394,324 bp
  • G to A, chromosome 5 at 67,315,701 bp
  • A to G, chromosome 5 at 139,972,473 bp
  • G to A, chromosome 5 at 146,484,370 bp
  • A to G, chromosome 6 at 48,444,969 bp
  • G to A, chromosome 6 at 88,613,983 bp
  • A to G, chromosome 6 at 93,683,089 bp
  • G to A, chromosome 6 at 118,539,727 bp
  • T to G, chromosome 7 at 6,268,802 bp
  • C to T, chromosome 7 at 28,962,084 bp
  • AGTGT to AGT, chromosome 7 at 55,928,189 bp
  • A to T, chromosome 7 at 58,797,471 bp
  • A to G, chromosome 7 at 64,219,106 bp
  • A to G, chromosome 7 at 66,332,386 bp
  • A to T, chromosome 7 at 102,614,767 bp
  • T to C, chromosome 7 at 105,810,002 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 8 at 84,172,213 bp
  • G to A, chromosome 8 at 93,984,856 bp
  • T to A, chromosome 8 at 123,221,998 bp
  • G to A, chromosome 9 at 37,773,415 bp
  • C to T, chromosome 9 at 44,075,969 bp
  • T to C, chromosome 9 at 88,394,561 bp
  • T to C, chromosome 9 at 90,185,815 bp
  • T to C, chromosome 9 at 122,852,143 bp
  • T to C, chromosome 10 at 24,776,884 bp
  • A to G, chromosome 10 at 40,926,550 bp
  • G to A, chromosome 10 at 41,561,191 bp
  • T to A, chromosome 10 at 75,574,276 bp
  • A to G, chromosome 10 at 93,845,993 bp
  • C to T, chromosome 10 at 111,275,011 bp
  • T to A, chromosome 10 at 127,458,153 bp
  • A to G, chromosome 11 at 8,945,241 bp
  • A to G, chromosome 11 at 54,986,167 bp
  • T to C, chromosome 11 at 82,892,325 bp
  • T to C, chromosome 11 at 97,932,327 bp
  • T to C, chromosome 11 at 103,182,769 bp
  • A to T, chromosome 11 at 120,534,712 bp
  • G to A, chromosome 12 at 69,263,149 bp
  • C to A, chromosome 12 at 69,955,353 bp
  • G to A, chromosome 12 at 110,617,762 bp
  • A to G, chromosome 13 at 100,809,254 bp
  • G to T, chromosome 14 at 31,370,721 bp
  • T to G, chromosome 14 at 49,080,927 bp
  • C to G, chromosome 14 at 59,228,379 bp
  • A to T, chromosome 14 at 87,477,403 bp
  • T to C, chromosome 14 at 88,469,075 bp
  • A to T, chromosome 15 at 73,696,132 bp
  • T to A, chromosome 15 at 82,557,648 bp
  • A to C, chromosome 15 at 96,691,359 bp
  • A to G, chromosome 15 at 101,143,364 bp
  • A to T, chromosome 16 at 19,769,753 bp
  • A to T, chromosome 17 at 25,242,595 bp
  • T to A, chromosome 17 at 36,056,439 bp
  • T to A, chromosome 18 at 59,408,975 bp
  • A to T, chromosome 19 at 5,706,777 bp
  • T to C, chromosome 19 at 12,120,548 bp
  • T to C, chromosome 19 at 37,290,761 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7224 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045296-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.