Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7305Btlr/Mmmh
Stock Number:
045407-MU
Citation ID:
RRID:MMRRC_045407-MU
Other Names:
R7305 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Eno1
Name: enolase 1, alpha non-neuron
Synonyms: 2-phospho-D-glycerate hydrolase, alpha-enolase, Eno-1, MBP-1, c-Myc promoter binding protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13806
HGNC: HGNC:3350
Homologene: 134343
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Prdm5
Name: PR domain containing 5
Synonyms: 6530401I24Rik, E130112L17Rik, PFM2, 4432417F03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70779
HGNC: HGNC:9349
Homologene: 10274
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Armh3
Name: armadillo-like helical domain containing 3
Synonyms: 9130011E15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71617
VEGA: 19
Homologene: 15843
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 24,030,858 bp
  • C to T, chromosome 1 at 75,493,946 bp
  • T to C, chromosome 1 at 96,828,965 bp
  • C to T, chromosome 1 at 185,379,701 bp
  • A to T, chromosome 2 at 20,709,557 bp
  • A to C, chromosome 2 at 31,930,702 bp
  • T to A, chromosome 2 at 89,656,502 bp
  • A to G, chromosome 2 at 121,299,458 bp
  • C to A, chromosome 2 at 130,281,493 bp
  • T to A, chromosome 2 at 134,548,201 bp
  • A to T, chromosome 2 at 181,493,416 bp
  • T to C, chromosome 3 at 57,692,517 bp
  • G to T, chromosome 3 at 85,730,524 bp
  • T to C, chromosome 3 at 88,333,411 bp
  • T to C, chromosome 3 at 123,601,482 bp
  • T to A, chromosome 4 at 104,713,790 bp
  • T to C, chromosome 4 at 150,245,339 bp
  • C to T, chromosome 5 at 30,917,089 bp
  • T to C, chromosome 5 at 32,831,101 bp
  • T to C, chromosome 5 at 38,540,092 bp
  • T to C, chromosome 5 at 137,415,139 bp
  • A to G, chromosome 5 at 145,370,985 bp
  • A to T, chromosome 6 at 27,761,355 bp
  • C to A, chromosome 6 at 65,831,260 bp
  • A to G, chromosome 6 at 70,260,569 bp
  • T to C, chromosome 6 at 91,087,966 bp
  • A to T, chromosome 6 at 141,924,497 bp
  • G to A, chromosome 6 at 141,992,494 bp
  • A to T, chromosome 7 at 3,645,480 bp
  • T to C, chromosome 7 at 42,764,811 bp
  • C to A, chromosome 7 at 47,335,455 bp
  • AGTGT to AGT, chromosome 7 at 55,928,189 bp
  • T to A, chromosome 7 at 56,735,085 bp
  • GGCGGCGGC to GGCGGCGGCAGCGGCGGC, chromosome 7 at 97,579,918 bp
  • G to T, chromosome 7 at 102,587,955 bp
  • A to T, chromosome 7 at 107,845,365 bp
  • G to A, chromosome 8 at 4,325,199 bp
  • G to A, chromosome 8 at 72,373,034 bp
  • T to C, chromosome 8 at 111,915,295 bp
  • A to G, chromosome 9 at 44,795,408 bp
  • A to G, chromosome 9 at 66,461,868 bp
  • A to T, chromosome 9 at 103,328,637 bp
  • A to T, chromosome 10 at 12,385,536 bp
  • A to G, chromosome 10 at 18,531,686 bp
  • A to G, chromosome 10 at 76,000,399 bp
  • A to C, chromosome 10 at 77,548,564 bp
  • A to G, chromosome 10 at 81,271,233 bp
  • A to T, chromosome 10 at 82,285,119 bp
  • A to G, chromosome 10 at 127,476,678 bp
  • A to T, chromosome 10 at 129,682,280 bp
  • T to A, chromosome 10 at 129,767,851 bp
  • G to T, chromosome 11 at 29,777,258 bp
  • GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG to GTCTACACTGTCCTG, chromosome 11 at 33,623,355 bp
  • T to C, chromosome 11 at 43,717,051 bp
  • A to T, chromosome 11 at 77,541,674 bp
  • A to G, chromosome 12 at 11,457,343 bp
  • A to G, chromosome 12 at 17,274,508 bp
  • A to G, chromosome 12 at 78,715,035 bp
  • A to T, chromosome 13 at 23,163,144 bp
  • T to A, chromosome 13 at 58,566,231 bp
  • A to G, chromosome 13 at 78,195,179 bp
  • A to G, chromosome 13 at 96,878,971 bp
  • A to T, chromosome 13 at 100,811,424 bp
  • A to G, chromosome 13 at 116,894,925 bp
  • T to C, chromosome 14 at 70,240,803 bp
  • A to T, chromosome 14 at 118,267,356 bp
  • A to G, chromosome 15 at 27,658,233 bp
  • C to T, chromosome 15 at 41,813,608 bp
  • G to A, chromosome 15 at 64,130,250 bp
  • A to T, chromosome 15 at 99,513,933 bp
  • T to A, chromosome 16 at 17,641,783 bp
  • T to A, chromosome 16 at 19,487,699 bp
  • T to C, chromosome 16 at 97,951,295 bp
  • A to T, chromosome 17 at 25,830,327 bp
  • G to A, chromosome 18 at 11,672,581 bp
  • A to G, chromosome 18 at 36,632,205 bp
  • A to G, chromosome 18 at 74,219,396 bp
  • G to A, chromosome 19 at 8,622,158 bp
  • A to T, chromosome 19 at 18,876,091 bp
  • A to T, chromosome 19 at 45,892,121 bp
  • T to A, chromosome Y at 821,348 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7305 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045407-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.