MMRRC:045460-MU

A to G, chromosome 1 at 23,996,358 bp
A to T, chromosome 1 at 25,531,919 bp
G to A, chromosome 1 at 45,327,647 bp
T to C, chromosome 1 at 52,480,995 bp
T to C, chromosome 1 at 58,530,034 bp
C to T, chromosome 1 at 93,194,087 bp
T to C, chromosome 1 at 118,848,492 bp
C to T, chromosome 1 at 155,098,692 bp
T to C, chromosome 1 at 159,884,862 bp
T to C, chromosome 1 at 161,862,211 bp
G to T, chromosome 1 at 166,112,063 bp
T to A, chromosome 1 at 172,538,343 bp
CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
A to G, chromosome 1 at 183,334,775 bp
T to A, chromosome 2 at 24,094,700 bp
T to A, chromosome 2 at 26,912,007 bp
T to A, chromosome 2 at 41,295,669 bp
T to C, chromosome 2 at 86,456,068 bp
A to G, chromosome 2 at 92,413,664 bp
C to A, chromosome 2 at 122,058,429 bp
T to G, chromosome 2 at 130,438,179 bp
T to C, chromosome 2 at 153,401,993 bp
C to A, chromosome 2 at 153,986,433 bp
T to C, chromosome 2 at 162,934,569 bp
A to G, chromosome 2 at 173,112,258 bp
T to A, chromosome 3 at 84,972,637 bp
A to G, chromosome 3 at 138,288,887 bp
A to G, chromosome 4 at 6,416,586 bp
A to T, chromosome 4 at 34,808,384 bp
A to G, chromosome 4 at 41,235,515 bp
A to G, chromosome 4 at 48,663,631 bp
C to T, chromosome 4 at 52,856,421 bp
A to G, chromosome 4 at 108,002,203 bp
T to A, chromosome 4 at 116,270,830 bp
T to C, chromosome 4 at 117,162,029 bp
T to C, chromosome 4 at 118,754,175 bp
C to T, chromosome 4 at 126,511,464 bp
A to G, chromosome 5 at 31,527,527 bp
A to T, chromosome 5 at 34,803,799 bp
A to T, chromosome 5 at 53,116,409 bp
T to C, chromosome 5 at 64,925,228 bp
A to T, chromosome 5 at 67,286,133 bp
T to C, chromosome 5 at 86,046,499 bp
T to A, chromosome 5 at 90,551,400 bp
T to C, chromosome 5 at 96,596,785 bp
A to T, chromosome 5 at 107,723,229 bp
G to A, chromosome 5 at 138,281,960 bp
A to G, chromosome 6 at 17,282,060 bp
C to T, chromosome 6 at 51,457,296 bp
T to A, chromosome 6 at 65,110,376 bp
C to T, chromosome 6 at 83,563,906 bp
T to C, chromosome 6 at 113,704,701 bp
A to C, chromosome 6 at 128,546,247 bp
A to G, chromosome 7 at 25,348,942 bp
C to T, chromosome 7 at 26,365,015 bp
A to G, chromosome 7 at 28,396,928 bp
C to A, chromosome 7 at 35,752,642 bp
T to C, chromosome 7 at 45,361,446 bp
T to A, chromosome 7 at 75,147,728 bp
T to A, chromosome 7 at 103,767,930 bp
A to T, chromosome 7 at 104,939,431 bp
T to C, chromosome 7 at 108,081,192 bp
C to A, chromosome 7 at 113,299,208 bp
T to C, chromosome 7 at 128,704,517 bp
A to G, chromosome 8 at 3,198,231 bp
A to G, chromosome 8 at 22,804,010 bp
T to C, chromosome 8 at 70,769,381 bp
A to T, chromosome 8 at 85,019,863 bp
A to G, chromosome 8 at 106,981,312 bp
A to G, chromosome 8 at 108,793,248 bp
A to G, chromosome 8 at 111,042,342 bp
A to T, chromosome 8 at 114,289,392 bp
T to A, chromosome 8 at 122,481,499 bp
T to A, chromosome 9 at 19,497,102 bp
A to T, chromosome 9 at 19,712,887 bp
T to A, chromosome 9 at 38,975,721 bp
C to T, chromosome 9 at 44,778,595 bp
T to G, chromosome 9 at 53,453,437 bp
T to C, chromosome 9 at 83,395,530 bp
A to G, chromosome 10 at 14,535,892 bp
T to G, chromosome 10 at 61,727,717 bp
T to G, chromosome 10 at 68,724,092 bp
T to C, chromosome 10 at 78,193,418 bp
T to C, chromosome 10 at 78,426,988 bp
C to G, chromosome 10 at 79,396,442 bp
C to A, chromosome 10 at 80,311,394 bp
C to T, chromosome 10 at 128,671,041 bp
C to T, chromosome 11 at 7,169,543 bp
A to G, chromosome 11 at 44,407,894 bp
A to G, chromosome 11 at 70,772,073 bp
T to A, chromosome 11 at 76,077,074 bp
T to A, chromosome 11 at 94,114,351 bp
A to C, chromosome 11 at 97,747,997 bp
T to C, chromosome 11 at 104,714,702 bp
T to A, chromosome 11 at 115,794,174 bp
T to G, chromosome 11 at 115,821,705 bp
T to C, chromosome 11 at 117,741,780 bp
T to A, chromosome 12 at 13,274,219 bp
A to G, chromosome 12 at 21,112,051 bp
T to C, chromosome 12 at 40,315,853 bp
T to A, chromosome 12 at 40,788,244 bp
A to G, chromosome 12 at 53,142,574 bp
C to A, chromosome 12 at 59,204,371 bp
C to T, chromosome 12 at 102,239,176 bp
A to T, chromosome 13 at 20,280,935 bp
A to G, chromosome 13 at 21,192,461 bp
G to A, chromosome 13 at 32,816,281 bp
A to G, chromosome 13 at 68,564,402 bp
A to T, chromosome 13 at 73,267,553 bp
C to T, chromosome 13 at 95,618,328 bp
C to T, chromosome 13 at 95,732,890 bp
T to C, chromosome 13 at 99,229,515 bp
A to G, chromosome 13 at 100,127,865 bp
T to A, chromosome 14 at 14,757,421 bp
T to C, chromosome 14 at 110,749,863 bp
C to T, chromosome 14 at 123,302,890 bp
A to G, chromosome 14 at 123,857,489 bp
T to A, chromosome 15 at 34,839,703 bp
T to A, chromosome 15 at 37,931,647 bp
T to C, chromosome 15 at 68,181,120 bp
C to T, chromosome 15 at 74,817,121 bp
T to C, chromosome 15 at 81,650,545 bp
C to A, chromosome 15 at 89,085,290 bp
T to A, chromosome 15 at 89,089,478 bp
T to A, chromosome 15 at 101,738,329 bp
T to A, chromosome 16 at 5,112,996 bp
T to G, chromosome 16 at 17,211,204 bp
T to C, chromosome 16 at 17,776,805 bp
T to A, chromosome 16 at 57,146,044 bp
T to A, chromosome 16 at 59,215,920 bp
T to C, chromosome 17 at 12,612,391 bp
A to G, chromosome 17 at 24,418,530 bp
A to T, chromosome 17 at 35,825,513 bp
T to A, chromosome 18 at 31,966,239 bp
T to C, chromosome 18 at 35,213,592 bp
C to A, chromosome 18 at 36,939,385 bp
G to A, chromosome 18 at 37,335,172 bp
A to T, chromosome 18 at 74,805,872 bp
A to T, chromosome 18 at 78,857,486 bp
G to A, chromosome 19 at 5,089,790 bp
A to T, chromosome 19 at 20,868,389 bp
T to A, chromosome 19 at 44,153,715 bp
C to T, chromosome 19 at 45,045,606 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R7378 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
045460-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All